ID: 1075579892

View in Genome Browser
Species Human (GRCh38)
Location 10:123609468-123609490
Sequence TGGGTACTCACACGAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075579892_1075579900 13 Left 1075579892 10:123609468-123609490 CCAGGCTTTCGTGTGAGTACCCA No data
Right 1075579900 10:123609504-123609526 AGAGGACCGTGCACCCATGTGGG No data
1075579892_1075579895 -5 Left 1075579892 10:123609468-123609490 CCAGGCTTTCGTGTGAGTACCCA No data
Right 1075579895 10:123609486-123609508 ACCCAGCATGGCCTGTGGAGAGG No data
1075579892_1075579899 12 Left 1075579892 10:123609468-123609490 CCAGGCTTTCGTGTGAGTACCCA No data
Right 1075579899 10:123609503-123609525 GAGAGGACCGTGCACCCATGTGG No data
1075579892_1075579894 -10 Left 1075579892 10:123609468-123609490 CCAGGCTTTCGTGTGAGTACCCA No data
Right 1075579894 10:123609481-123609503 TGAGTACCCAGCATGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075579892 Original CRISPR TGGGTACTCACACGAAAGCC TGG (reversed) Intergenic