ID: 1075579894

View in Genome Browser
Species Human (GRCh38)
Location 10:123609481-123609503
Sequence TGAGTACCCAGCATGGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075579890_1075579894 -8 Left 1075579890 10:123609466-123609488 CCCCAGGCTTTCGTGTGAGTACC No data
Right 1075579894 10:123609481-123609503 TGAGTACCCAGCATGGCCTGTGG No data
1075579891_1075579894 -9 Left 1075579891 10:123609467-123609489 CCCAGGCTTTCGTGTGAGTACCC No data
Right 1075579894 10:123609481-123609503 TGAGTACCCAGCATGGCCTGTGG No data
1075579889_1075579894 -7 Left 1075579889 10:123609465-123609487 CCCCCAGGCTTTCGTGTGAGTAC No data
Right 1075579894 10:123609481-123609503 TGAGTACCCAGCATGGCCTGTGG No data
1075579892_1075579894 -10 Left 1075579892 10:123609468-123609490 CCAGGCTTTCGTGTGAGTACCCA No data
Right 1075579894 10:123609481-123609503 TGAGTACCCAGCATGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075579894 Original CRISPR TGAGTACCCAGCATGGCCTG TGG Intergenic
No off target data available for this crispr