ID: 1075579897

View in Genome Browser
Species Human (GRCh38)
Location 10:123609488-123609510
Sequence GTCCTCTCCACAGGCCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075579897_1075579909 26 Left 1075579897 10:123609488-123609510 CCAGCATGGCCTGTGGAGAGGAC No data
Right 1075579909 10:123609537-123609559 CCCTTCTGTCTGTGGCCCCAGGG No data
1075579897_1075579907 25 Left 1075579897 10:123609488-123609510 CCAGCATGGCCTGTGGAGAGGAC No data
Right 1075579907 10:123609536-123609558 CCCCTTCTGTCTGTGGCCCCAGG No data
1075579897_1075579904 18 Left 1075579897 10:123609488-123609510 CCAGCATGGCCTGTGGAGAGGAC No data
Right 1075579904 10:123609529-123609551 CAACTTCCCCCTTCTGTCTGTGG No data
1075579897_1075579899 -8 Left 1075579897 10:123609488-123609510 CCAGCATGGCCTGTGGAGAGGAC No data
Right 1075579899 10:123609503-123609525 GAGAGGACCGTGCACCCATGTGG No data
1075579897_1075579900 -7 Left 1075579897 10:123609488-123609510 CCAGCATGGCCTGTGGAGAGGAC No data
Right 1075579900 10:123609504-123609526 AGAGGACCGTGCACCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075579897 Original CRISPR GTCCTCTCCACAGGCCATGC TGG (reversed) Intergenic
No off target data available for this crispr