ID: 1075581307

View in Genome Browser
Species Human (GRCh38)
Location 10:123620558-123620580
Sequence GAATCTGACACTCAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075581305_1075581307 6 Left 1075581305 10:123620529-123620551 CCAGACGATCACTTTCATTTTAA No data
Right 1075581307 10:123620558-123620580 GAATCTGACACTCAGGAGACAGG No data
1075581304_1075581307 14 Left 1075581304 10:123620521-123620543 CCTGTAGGCCAGACGATCACTTT No data
Right 1075581307 10:123620558-123620580 GAATCTGACACTCAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075581307 Original CRISPR GAATCTGACACTCAGGAGAC AGG Intergenic
No off target data available for this crispr