ID: 1075583773

View in Genome Browser
Species Human (GRCh38)
Location 10:123642877-123642899
Sequence CTGAGCAATGGGAAGTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075583770_1075583773 3 Left 1075583770 10:123642851-123642873 CCAGAAGGTGGTGCTAACTGCAG No data
Right 1075583773 10:123642877-123642899 CTGAGCAATGGGAAGTTCAAAGG No data
1075583768_1075583773 17 Left 1075583768 10:123642837-123642859 CCTACGTTTTGCTTCCAGAAGGT No data
Right 1075583773 10:123642877-123642899 CTGAGCAATGGGAAGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075583773 Original CRISPR CTGAGCAATGGGAAGTTCAA AGG Intergenic
No off target data available for this crispr