ID: 1075585261

View in Genome Browser
Species Human (GRCh38)
Location 10:123652637-123652659
Sequence AAGCTGATCAAGAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075585252_1075585261 28 Left 1075585252 10:123652586-123652608 CCATGGATGTGACGCTGATGATA No data
Right 1075585261 10:123652637-123652659 AAGCTGATCAAGAGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075585261 Original CRISPR AAGCTGATCAAGAGGGGAGA AGG Intergenic
No off target data available for this crispr