ID: 1075595024

View in Genome Browser
Species Human (GRCh38)
Location 10:123722898-123722920
Sequence TGGAGTATATCCATCACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075595017_1075595024 2 Left 1075595017 10:123722873-123722895 CCCCCCATATACACAGGGTACAG 0: 1
1: 0
2: 1
3: 12
4: 100
Right 1075595024 10:123722898-123722920 TGGAGTATATCCATCACGGCAGG No data
1075595019_1075595024 0 Left 1075595019 10:123722875-123722897 CCCCATATACACAGGGTACAGCA 0: 1
1: 0
2: 2
3: 10
4: 125
Right 1075595024 10:123722898-123722920 TGGAGTATATCCATCACGGCAGG No data
1075595020_1075595024 -1 Left 1075595020 10:123722876-123722898 CCCATATACACAGGGTACAGCAT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1075595024 10:123722898-123722920 TGGAGTATATCCATCACGGCAGG No data
1075595021_1075595024 -2 Left 1075595021 10:123722877-123722899 CCATATACACAGGGTACAGCATG 0: 1
1: 0
2: 0
3: 14
4: 92
Right 1075595024 10:123722898-123722920 TGGAGTATATCCATCACGGCAGG No data
1075595018_1075595024 1 Left 1075595018 10:123722874-123722896 CCCCCATATACACAGGGTACAGC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1075595024 10:123722898-123722920 TGGAGTATATCCATCACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075595024 Original CRISPR TGGAGTATATCCATCACGGC AGG Intronic
No off target data available for this crispr