ID: 1075596058

View in Genome Browser
Species Human (GRCh38)
Location 10:123730012-123730034
Sequence CCTCATCTGCAGAGGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075596058_1075596066 24 Left 1075596058 10:123730012-123730034 CCACCTTTCCTCTGCAGATGAGG 0: 1
1: 0
2: 6
3: 31
4: 325
Right 1075596066 10:123730059-123730081 TCACTTGCTTGGAATCACACAGG No data
1075596058_1075596065 13 Left 1075596058 10:123730012-123730034 CCACCTTTCCTCTGCAGATGAGG 0: 1
1: 0
2: 6
3: 31
4: 325
Right 1075596065 10:123730048-123730070 GCAGAATGAAGTCACTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075596058 Original CRISPR CCTCATCTGCAGAGGAAAGG TGG (reversed) Intronic
900932966 1:5748175-5748197 CATCACCTGGAGGGGAAAGGGGG - Intergenic
901405630 1:9043378-9043400 CCTCATTTGCAGAGCAAAGAGGG + Intronic
901566414 1:10119496-10119518 GCACATCTGAAAAGGAAAGGTGG - Exonic
902176482 1:14654596-14654618 CCTCCTCTGCAGTGGAAAACAGG + Intronic
902295187 1:15462387-15462409 CCCCATCTGCAAATGAAAGGTGG + Intronic
903179270 1:21597259-21597281 CCTCATCTGCAGGGCAAAGGGGG + Exonic
903857118 1:26344030-26344052 CATCATCTCCAGAGGAGAGCAGG + Exonic
904066371 1:27755011-27755033 GCTGAACTGCAGAGGTAAGGTGG - Intronic
904376367 1:30084933-30084955 GCTCAGCTGCAGAGAAGAGGGGG - Intergenic
904684394 1:32250109-32250131 CCTCAGCTGCAGAGAGAAGTGGG - Intergenic
905490996 1:38343673-38343695 CCTCAGCTGCAGAAGCAAAGAGG + Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
908271987 1:62431135-62431157 TCTCATCTGCAGGGGAAGGGTGG - Intergenic
909694661 1:78453384-78453406 GCTAACCTACAGAGGAAAGGTGG - Intronic
912845857 1:113073893-113073915 CCTCAACTGGGGAGGAAATGGGG + Intronic
914959451 1:152193466-152193488 CCCCATCAACAGAGAAAAGGTGG + Intergenic
915042801 1:152982936-152982958 CATGATCTGTAGAGGAAAAGTGG + Intergenic
915087582 1:153398595-153398617 TCTCATCTCCAGAGGAAGTGGGG - Intergenic
915980369 1:160416403-160416425 CCTTATCTCCAGAGGAGTGGGGG + Intronic
916579865 1:166097423-166097445 TCTCAGCTGCAGAAGAAAAGGGG - Intronic
916767419 1:167875146-167875168 CCTCATCTGCAACAGAAAGGAGG - Exonic
918304154 1:183230610-183230632 CCTCATCTGCAAAATAGAGGGGG + Intronic
920509484 1:206540362-206540384 TCTCTCCAGCAGAGGAAAGGGGG - Intronic
920669734 1:207993989-207994011 GCTCAGCTCCAGAGGACAGGGGG + Intergenic
921165494 1:212503926-212503948 GCTCATCTGCATAATAAAGGAGG - Intergenic
923538230 1:234869504-234869526 CATCATCTGCAGAGATAAGCAGG - Intergenic
923745221 1:236693690-236693712 CCTCATCTCCGCAGGGAAGGTGG - Intronic
924927164 1:248694169-248694191 TCTGATCAGCAGAGCAAAGGAGG - Intergenic
1063039265 10:2320136-2320158 CCTCTGCTGAAGAGGAGAGGTGG + Intergenic
1063061978 10:2565319-2565341 CCACATCCTCAGAGGAAATGTGG - Intergenic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1065734569 10:28740091-28740113 CCCAATCTGCAGAGAAAATGAGG + Intergenic
1065828041 10:29589554-29589576 CGGCAGCTGAAGAGGAAAGGGGG - Intronic
1065949718 10:30641053-30641075 CGGCAGCTGAAGAGGAAAGGGGG + Intergenic
1067239290 10:44476649-44476671 GCTCCTCTGCAGAGGCAAGCTGG - Intergenic
1068044781 10:51872105-51872127 CTTCAGGTGCAGAGGAGAGGCGG - Intronic
1068701694 10:60026666-60026688 CCTTATTTACAGAGGAAAGGAGG + Exonic
1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG + Intergenic
1070796489 10:79219939-79219961 CATCTTCTGGAAAGGAAAGGGGG + Intronic
1071256588 10:83877261-83877283 CCTCATCTGCAGTGGAGGGATGG - Intergenic
1072072805 10:91936332-91936354 CCTGATGTGCAGAGTAAAGCAGG + Intronic
1074039285 10:109772213-109772235 CCTCATCTGAGGAGGCAGGGAGG - Intergenic
1074052083 10:109889056-109889078 CCTCATCTGCAAGGGCAGGGTGG + Intronic
1075353491 10:121747542-121747564 CCTGTGCTGAAGAGGAAAGGGGG - Intronic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1078639767 11:13083824-13083846 CATCAACTGCAAAAGAAAGGAGG + Intergenic
1078734923 11:14011097-14011119 ACTCAGCTGCCGAGGATAGGAGG - Intronic
1078851900 11:15171596-15171618 CCTGATCTCCAACGGAAAGGGGG + Intronic
1078986694 11:16605153-16605175 CCCCGGCTGCAGAGGAACGGCGG + Intronic
1079297096 11:19242838-19242860 CCTCAGCTGGCGACGAAAGGGGG - Intergenic
1079386299 11:19983129-19983151 CCTCATCTTCAGAGGAGAACAGG - Intronic
1079468351 11:20755095-20755117 CCTCCCCTGCAGGGAAAAGGAGG - Intronic
1080151052 11:29052371-29052393 CCTCATATGAAGAGGAAAAATGG + Intergenic
1080609992 11:33895548-33895570 CCTCATCTGCAGATGAAAAGTGG - Intergenic
1080688245 11:34533750-34533772 CCTCATGTGGAGAAAAAAGGGGG + Intergenic
1081072234 11:38625810-38625832 CCTCATCAGCCTGGGAAAGGTGG - Intergenic
1082790051 11:57340879-57340901 CCACCTCTGCAAAGGGAAGGAGG + Intronic
1083879979 11:65543544-65543566 CCACATCTGCAGGGCATAGGGGG + Exonic
1084165762 11:67374005-67374027 CCGCATCGGCAGGGGACAGGGGG - Intronic
1084778359 11:71392286-71392308 CCTCAGCTGCCGAGGGAAAGAGG - Intergenic
1085056409 11:73406739-73406761 CCAGATCTGCAGAGGGAAAGGGG + Exonic
1085877399 11:80425425-80425447 CATCATGTGCAAAGGAAAGAAGG - Intergenic
1086931609 11:92699710-92699732 TATCATCTGCAGAGGGAAGTAGG + Intronic
1087980207 11:104603300-104603322 CTTCATCTTCAGAGAGAAGGAGG + Intergenic
1089354632 11:117841683-117841705 CCTCTCCTGGAGAGGAAAGGAGG - Intronic
1090210825 11:124920148-124920170 CCTAATCTCCAGAGAAATGGTGG - Exonic
1090990830 11:131815585-131815607 TGTGCTCTGCAGAGGAAAGGGGG + Intronic
1091287517 11:134415987-134416009 CCTCAGCCACAGAGGAAAGAAGG - Intergenic
1091457507 12:618723-618745 CTCCATCTGCAGGGAAAAGGAGG + Intronic
1096673374 12:53213487-53213509 CCTCATCTGCGGAGGTGCGGGGG - Exonic
1096766520 12:53895215-53895237 CCTCATCATCAGAAGAAAGAAGG - Intergenic
1096957312 12:55539784-55539806 CCTCATGTGTAGCAGAAAGGTGG + Intergenic
1096979402 12:55719643-55719665 CCTCACCCGCAGGGGGAAGGAGG + Intronic
1097271864 12:57780435-57780457 CCCCAGCAGCAGAGGGAAGGTGG - Exonic
1097987472 12:65799114-65799136 CCTCATCTGCATAGCAAGGCAGG + Intergenic
1100000856 12:89833429-89833451 CCTCATCTGCAAAAGAAAAGAGG - Intergenic
1100150032 12:91725539-91725561 CCTCAACTCCACAGGAATGGAGG + Intergenic
1100313416 12:93419648-93419670 TTTCATTTGCAAAGGAAAGGTGG - Intronic
1102489213 12:113278822-113278844 CCTCATCTTCAAAGGTAAGTGGG + Exonic
1103915810 12:124375075-124375097 CCTCATCTGCACATGAGAGTTGG - Intronic
1104193527 12:126507685-126507707 CCTCATCTCCAGAGATATGGAGG - Intergenic
1104857856 12:131910237-131910259 ACTCATCTGCAGGAGGAAGGAGG - Exonic
1105411615 13:20176170-20176192 CCCCACCTCCAGAGGATAGGAGG - Intergenic
1106589874 13:31089947-31089969 CCTCACCTGCAGAGGAATCAAGG - Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108870420 13:54977443-54977465 CCTCATATGTGGGGGAAAGGTGG + Intergenic
1109433414 13:62267009-62267031 CCTTATCTGCAGAGGCCAAGTGG - Intergenic
1109874786 13:68387182-68387204 ACTCAGCAGGAGAGGAAAGGTGG - Intergenic
1110240402 13:73260202-73260224 CATCATATGCAGAGGCCAGGGGG + Intergenic
1111168269 13:84491531-84491553 GCTCACCAGCAGAGGAGAGGAGG + Intergenic
1111919943 13:94399821-94399843 TCTCTTCTGAAGAGGAAAGGAGG - Intronic
1112776293 13:102846920-102846942 TCTCATCTGCAAAGTAGAGGTGG + Intronic
1113684490 13:112272933-112272955 CCTCATCTGGAGTGGGCAGGTGG + Intergenic
1114233403 14:20803377-20803399 CCAGATCTGGAGAAGAAAGGGGG + Intergenic
1114567727 14:23644869-23644891 CATCAGCTGCAGAGGCAAGTGGG + Exonic
1115648845 14:35388810-35388832 CCTCCTCTGCAGGGGAATGTGGG - Intergenic
1117514044 14:56482645-56482667 TCTCATCTGCAGAGGAATTGGGG + Intergenic
1117610385 14:57477074-57477096 CTTCATCTGTAGAAGAGAGGTGG + Intronic
1117642727 14:57817389-57817411 CAGCATCTCCAGTGGAAAGGAGG - Intronic
1118886477 14:69870986-69871008 ACTCATGTGGAGAGGAATGGAGG + Intronic
1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG + Intergenic
1119442600 14:74638323-74638345 CCTTATCAGCAGTGTAAAGGGGG - Intergenic
1120637404 14:86969056-86969078 CAGCATCTGCAAAGGAAAGTGGG - Intergenic
1120726951 14:87954428-87954450 CCTCAACTGCAAAGGAAAAAAGG + Intronic
1121606047 14:95240767-95240789 CCTCATCTACATAGGAAACATGG - Intronic
1122003878 14:98686283-98686305 CCTAGTCTGCAGGGGACAGGCGG + Intergenic
1122134533 14:99625251-99625273 CCTCCTCTGCAGATGGGAGGAGG - Intergenic
1122570222 14:102693169-102693191 CCTGATCTGCAGAATTAAGGAGG - Intronic
1122599852 14:102915767-102915789 CGTCACCTGCAGAGCAAGGGTGG - Intergenic
1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124954929 15:34354124-34354146 CCTCATCTGCCTAAGAAATGGGG + Intronic
1125344402 15:38704348-38704370 CCTCATCTGCTGTGGAAAGTGGG - Intergenic
1125957731 15:43802009-43802031 CCTCATGTGCAGATGCTAGGTGG + Exonic
1127026881 15:54816338-54816360 TTTCAACTGCAAAGGAAAGGGGG - Intergenic
1127052087 15:55094979-55095001 CTTCATCTGAAGGGAAAAGGAGG + Intergenic
1127464339 15:59229130-59229152 CCTCAACTGTTGAGGAATGGGGG - Intronic
1127859157 15:62978716-62978738 CCTCCTCTTCAGAGGACAGAGGG + Intergenic
1128487327 15:68106737-68106759 CCTGATCTGTAGAGTGAAGGGGG + Intronic
1128910427 15:71508615-71508637 CCTCATCTGCAAAGTAAAGGGGG + Intronic
1130241890 15:82201345-82201367 GCTCATCTACAAAGGAGAGGGGG + Intronic
1130458489 15:84139508-84139530 GCTCATCTACAAAGGAGAGGGGG - Intergenic
1131485713 15:92818753-92818775 ACTTCCCTGCAGAGGAAAGGTGG + Intergenic
1131645003 15:94331958-94331980 CCTTATCTGCAAAAGAAAGATGG + Intronic
1131854158 15:96575029-96575051 CATCAACTGCAGTGGAAAGGCGG + Intergenic
1131975241 15:97938903-97938925 CCTGGTATACAGAGGAAAGGAGG - Intergenic
1132011364 15:98279477-98279499 TCTGATCTGCAGAGAGAAGGTGG + Intergenic
1132321098 15:100926313-100926335 CCTCACGTGCACTGGAAAGGTGG - Intronic
1132683697 16:1153703-1153725 CAGCACCTGCAGAGGACAGGGGG - Exonic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134803590 16:17106908-17106930 CCTCATCCTCAGAGTAAAGCAGG - Exonic
1136772006 16:32848219-32848241 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1137381097 16:48000451-48000473 TTCCATCTGCAGAAGAAAGGGGG + Intergenic
1137402257 16:48163250-48163272 ACTGATGTGCAGAGCAAAGGAGG - Intergenic
1137926757 16:52547429-52547451 CCGCTTCGGCCGAGGAAAGGAGG - Intronic
1138273362 16:55712144-55712166 CCTCATCTGCTGAGAACAAGAGG + Intergenic
1138382252 16:56610788-56610810 CCTCATCTGTAGAAAAAAGATGG + Intergenic
1138911969 16:61411883-61411905 GCTCATGTGCAGTGGTAAGGGGG - Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139548370 16:67660279-67660301 CTTCCTCTTCCGAGGAAAGGCGG - Exonic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1140774841 16:78240176-78240198 CCTCATGAGAAGAGGAAAGCAGG + Intronic
1140976683 16:80066609-80066631 TCTCATCTGCAAATGAAAGATGG - Intergenic
1141035580 16:80622660-80622682 CCTCAACTTCAGAGGAAATTAGG + Intronic
1141522506 16:84590394-84590416 CACCATGTGCAGAGGACAGGAGG + Intronic
1141592338 16:85077286-85077308 CCTCCTCAGCCGAGGACAGGGGG - Intronic
1141735557 16:85850050-85850072 CCTCATCTGCAGAACAGAGTCGG + Intergenic
1142020727 16:87780492-87780514 CCTCATCCACAGAGGACAGAGGG + Intergenic
1203074427 16_KI270728v1_random:1110308-1110330 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1144522643 17:15964109-15964131 GCCCATCTGCAGAGATAAGGTGG + Intronic
1144523351 17:15969066-15969088 CCTCAGCTGCAGTGGAAGGAAGG - Intronic
1144575742 17:16428300-16428322 CCACAGCTGCGGAGGAAGGGAGG - Exonic
1144675496 17:17158933-17158955 CCCCATCTTCAGAAGACAGGTGG - Exonic
1145796579 17:27658959-27658981 CTCCAGCTGCAGGGGAAAGGAGG + Intergenic
1145811014 17:27764236-27764258 CTCCAGCTGCAGGGGAAAGGAGG + Intronic
1147664516 17:42138183-42138205 GTATATCTGCAGAGGAAAGGGGG + Intronic
1147811009 17:43169882-43169904 CCACATCTGCAGTGTAGAGGGGG - Intergenic
1148676994 17:49451426-49451448 CCTGATCTGATGAGGAAATGTGG + Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1150883662 17:69059795-69059817 CCTCATCAGCAGAACAAAGAAGG + Intronic
1151385118 17:73750485-73750507 CCTCATCAGCAGTGGAAACCGGG - Intergenic
1152459915 17:80437150-80437172 CAGCATCTGCAGAGTCAAGGAGG - Exonic
1154048428 18:10929947-10929969 CCTCAACTCCAAAGGAAAGAGGG - Intronic
1154083585 18:11280853-11280875 CTGCATCTGCAGAGGAAGTGCGG + Intergenic
1158396348 18:57081121-57081143 CTGCACCTGCAGAGGAAAGGGGG + Intergenic
1160670934 19:362813-362835 GCTCATCAGCAGAGAAACGGAGG + Intronic
1164790397 19:30972577-30972599 CCCCCTCTGCAGATGACAGGAGG + Intergenic
1166071946 19:40393086-40393108 CCTCACCGGCAGAGGGCAGGTGG + Intergenic
1166108912 19:40611135-40611157 CCACATCTGCACAGGGCAGGGGG - Exonic
1167019564 19:46863203-46863225 CCTCTGCTGCAGAGGCAAAGGGG + Intergenic
1167048410 19:47065116-47065138 CCTCATCTGCAGAGCCCTGGAGG - Exonic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1167615649 19:50531431-50531453 ACCCAGCTGCAGAGGGAAGGGGG + Intronic
1167677621 19:50897252-50897274 CCTAATATGAAGAGGAAAAGAGG + Intergenic
1168059366 19:53882656-53882678 CTTCATCTGGTGAGGGAAGGGGG + Exonic
1168136401 19:54355237-54355259 CCTCAGGTGCAGAGGCCAGGTGG + Exonic
1168609757 19:57789799-57789821 CCTTATCAGTAGAAGAAAGGGGG + Intronic
925196475 2:1930049-1930071 CCTCAGCTGGAGAGACAAGGAGG + Intronic
925695252 2:6570008-6570030 CCTCATCTGCACAGTAAGGTAGG - Intergenic
926207801 2:10846468-10846490 CTTCAAATTCAGAGGAAAGGGGG - Intergenic
926695354 2:15766837-15766859 CCTCAACTGCAGAGGAGGGGAGG + Intergenic
927240361 2:20915465-20915487 CCCCAGCAGCAGAGGAAAGATGG - Intergenic
928399109 2:30965307-30965329 CCTCAGCTGCAGAGGTGAGGAGG - Intronic
929870385 2:45754265-45754287 TTTCATCTGAAGAGGCAAGGAGG + Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930978448 2:57493146-57493168 TTTCATCTGCAGAGGAAATTGGG + Intergenic
932423337 2:71613915-71613937 CTCCATCTGCAGGGAAAAGGAGG + Intronic
932988997 2:76763569-76763591 ACTCATCTGCATAGGCTAGGTGG - Intronic
933260119 2:80123044-80123066 ACTTATCCCCAGAGGAAAGGAGG - Intronic
933727510 2:85435110-85435132 CCTCAGCTGCTGAGGTGAGGAGG + Exonic
933744596 2:85561422-85561444 CCTCCTCCGCAGAGCAATGGCGG - Exonic
933820528 2:86107016-86107038 CCTCATCTGCAGACTAGAGTTGG + Intronic
935331143 2:101978920-101978942 CCTCCTCTTCAGAGGGAAAGGGG - Intergenic
935810394 2:106791672-106791694 CCTCAAGGGCAGTGGAAAGGGGG - Intergenic
936598636 2:113873937-113873959 CCCCAACTGCAGAGGAAAAGTGG + Intergenic
938667915 2:133558290-133558312 CCTCCTCTCCAGAGCAAAGAAGG - Intronic
941248631 2:163133500-163133522 CCTCAGCAGCAGATGAATGGAGG + Intergenic
942276308 2:174326463-174326485 CCGCAGCTGCGGAGGAGAGGAGG + Intergenic
943802162 2:192074300-192074322 CCTCATATGTTGAGGAAAAGGGG + Intronic
947606776 2:231491223-231491245 GCTCTTCTGCAGAGGAAACTTGG - Intergenic
947715480 2:232336906-232336928 CCTCCTCTGCCCAGGAAATGGGG + Exonic
947793019 2:232878435-232878457 CCTCTGCTGCAGTGGAAATGAGG - Intronic
948217828 2:236244941-236244963 CCTCCTCTGTAGAAGAGAGGTGG - Intronic
948292201 2:236834016-236834038 CTTCATCTCCAAAGGAAATGAGG - Intergenic
949072384 2:242033410-242033432 CCTCATCTGCACATGACATGGGG - Intergenic
1168877667 20:1182442-1182464 CCTCGGCTTCAGAAGAAAGGAGG + Intronic
1170547071 20:17443532-17443554 CCATGTCTGCTGAGGAAAGGGGG - Intronic
1171306607 20:24112458-24112480 CCTCCACTACAGAGGAAAGCCGG + Intergenic
1171544346 20:25989207-25989229 CCACATCTGCTGAGAAAAGAAGG - Intergenic
1171967330 20:31540363-31540385 CCTAATCAGCATGGGAAAGGAGG - Intronic
1172577540 20:36020861-36020883 CAGCAGCTTCAGAGGAAAGGTGG + Intronic
1173600249 20:44289816-44289838 CATAATCTGCAGAGGTAAGTAGG - Intergenic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1174802618 20:53576828-53576850 CCTCATCTGTAGAACCAAGGCGG - Exonic
1175756508 20:61533575-61533597 CCTCATGGGCAGAGGAAGGCAGG - Intronic
1175838847 20:62014187-62014209 CCTCATCTGCAAAGTAGAGATGG - Intronic
1176154668 20:63612651-63612673 CCACAGTTGCAGAGGAAAGTGGG - Intronic
1176168740 20:63687746-63687768 CTGCATCTCCAGAGCAAAGGAGG - Exonic
1178490516 21:33048123-33048145 CCCCACCTGCAGAGGCAAGCAGG + Intergenic
1178932250 21:36829808-36829830 CCTCTCCCGCAGAGGGAAGGAGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180799736 22:18626174-18626196 CCTCATCTGCTCAAGAAGGGAGG - Intergenic
1181221979 22:21369092-21369114 CCTCATCTGCTCAAGAAGGGAGG + Intergenic
1181637368 22:24180731-24180753 CCTCATCTGCTCAAGAAGGGAGG + Intergenic
1181727723 22:24823128-24823150 CCTCATCTGTAAAGTAAAGAGGG + Intronic
1182300749 22:29335593-29335615 CATCAGCTGCTGTGGAAAGGGGG - Intronic
1182948241 22:34345298-34345320 TCTCATATTCAGAGGAAAGCAGG + Intergenic
1183340100 22:37275337-37275359 CTTCATCTACACAGGAGAGGAGG + Intergenic
1183396556 22:37574779-37574801 CCTCCTCTGCAGAGAGGAGGCGG - Intronic
1184436181 22:44478799-44478821 CCTTATCTTCAGAGAAATGGTGG + Intergenic
1184916821 22:47575036-47575058 CCTCAGCTCCAGAGGAAGGAGGG - Intergenic
950336600 3:12199508-12199530 CCTCATGAGCAGAGGCAAGTAGG - Intergenic
950867887 3:16203935-16203957 CCTCACATGGAGAGGAGAGGGGG + Intronic
952273685 3:31857115-31857137 CTCCATCTGCAGAGGGCAGGGGG - Intronic
952505619 3:34004545-34004567 CCTCATCTCCAGAAGAACCGAGG + Intergenic
952695210 3:36257456-36257478 CCTCATCTGAAGGGGAAATCAGG + Intergenic
953124151 3:40075723-40075745 TCTCTTCTGTAGAAGAAAGGGGG + Intronic
953308619 3:41854449-41854471 CCTTATCTGCACAGACAAGGTGG + Intronic
953626854 3:44579036-44579058 CCCCATCTTCAGAAGACAGGTGG + Intronic
955485496 3:59430546-59430568 CATTATCTGCAGAGGAAAATTGG + Intergenic
956886521 3:73565479-73565501 CCTCATCTGAAAAGGAGAGAAGG + Intronic
961409825 3:126712057-126712079 CCTCAGCTGCTGAGGAGTGGAGG + Intronic
961543399 3:127615964-127615986 ACACCCCTGCAGAGGAAAGGTGG - Intronic
961580202 3:127874724-127874746 CTTCATCTGCAGAGGAAGCCAGG + Intergenic
961678704 3:128584301-128584323 CCCCATCAGCAGAGGGAAGGAGG - Intergenic
964118058 3:153156280-153156302 TCTCACCTGCAGAAGAAAAGGGG + Intergenic
965510826 3:169566419-169566441 CCTGATCTGCAGAGCAGAGAGGG - Intronic
966828240 3:183983625-183983647 CACCACCTGCAGAGGGAAGGCGG + Intronic
966902526 3:184497150-184497172 CCTCCTCTGGGGAGGAAAGTTGG + Intronic
967805384 3:193710971-193710993 CCTCCTCTGAAAATGAAAGGGGG - Intergenic
967946276 3:194806620-194806642 CCTCATCTGTAAAACAAAGGAGG + Intergenic
967968375 3:194981718-194981740 CTTCCTCTGGAAAGGAAAGGAGG + Intergenic
968789981 4:2652945-2652967 CCACATCTGCAGATGACAGGAGG + Intronic
970229094 4:13890749-13890771 CCCCATCTGCAAAGGTAAGTGGG + Intergenic
974172424 4:58282910-58282932 CAACATCTGCAGAGAAAAGGGGG + Intergenic
974977700 4:68911787-68911809 CCTGATGTGCAGATTAAAGGAGG + Intergenic
974987577 4:69047824-69047846 CCTGATGTGCAGATTAAAGGAGG - Intronic
975271576 4:72441626-72441648 CCTAATCTGCAGGGGAATGTTGG - Intronic
976087327 4:81419792-81419814 CCTCATCTGCAGAGGATTGGGGG - Intergenic
976147980 4:82062362-82062384 CCTCACCTCCACAGGAAAGTTGG + Intergenic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
977248389 4:94660767-94660789 CCTCAGCTGGAGAGGAAGGCAGG - Intronic
980395862 4:132214366-132214388 CCTCATCTTTAGAGGTAAAGAGG - Intergenic
980625607 4:135371464-135371486 CTCCATCTGCAGAGCACAGGGGG + Intergenic
980666902 4:135952230-135952252 CCTCATTTCCAGAGGAAAAGTGG + Intergenic
980795852 4:137681568-137681590 CCTCATGTACAGAGGAAAAAGGG + Intergenic
982639099 4:157934171-157934193 CTTCATCTGTAAAGTAAAGGTGG + Intergenic
983491802 4:168398134-168398156 CCAAACCTGCAGAGGGAAGGGGG - Intronic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
984426589 4:179595819-179595841 TCTCTTCTGCAGAGGCCAGGCGG + Intergenic
985508432 5:298521-298543 CCTCATCTGCACATGACATGGGG - Intronic
985739615 5:1607147-1607169 CCTCATCTGCACATGACATGGGG + Intergenic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
985861179 5:2471709-2471731 CCACATCAGCAGAGGAGAGAAGG + Intergenic
989497617 5:42127085-42127107 CCTCATCTGCAAAGTAGAGGTGG - Intergenic
990337295 5:54787243-54787265 CCTCATCTGTAGAAGACAAGGGG + Intergenic
991980157 5:72222024-72222046 ACTCATTGGCACAGGAAAGGAGG + Intronic
992009077 5:72509283-72509305 CATCAGCAGCAGAGGAAAGGAGG + Intergenic
992012329 5:72541306-72541328 CATCAGCAGCAGAGGAAAGGAGG + Intergenic
993125065 5:83823929-83823951 CCTCAAATGAAGATGAAAGGAGG - Intergenic
993364577 5:87020096-87020118 CCACCTCTGCACAGGAAGGGAGG + Intergenic
993905934 5:93622625-93622647 GCCAGTCTGCAGAGGAAAGGAGG - Intronic
993929459 5:93920310-93920332 CCTCATCTGAAAAGGGAAGATGG - Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
996503321 5:124240819-124240841 CTTCATATGGAGAGGAAAGATGG + Intergenic
997406530 5:133653312-133653334 CATCATCTGCTGAGGAGATGAGG - Intergenic
999847524 5:155500964-155500986 GCTCATCTGAAGAGAAATGGAGG + Intergenic
1000460846 5:161516353-161516375 CCTCATCTGCAAAGCAGGGGTGG - Intronic
1000703882 5:164487600-164487622 CCTGGTGTGTAGAGGAAAGGAGG - Intergenic
1002402509 5:178999037-178999059 CCTCATGAGCAGAGGACAAGAGG - Intergenic
1002533849 5:179865350-179865372 CCTAACCTGCAGAGGAGAAGGGG - Exonic
1002760731 6:199997-200019 CATCATCTGCATAGGAAACCAGG - Intergenic
1002848666 6:971712-971734 CCTCATCAGAAGAGGAGATGAGG - Intergenic
1002984445 6:2175041-2175063 CATCATCTGAAGGGGAAGGGGGG + Intronic
1003679588 6:8238892-8238914 CATGATCTTCAGAGAAAAGGCGG - Intergenic
1004555034 6:16688395-16688417 GCTCAACTCCAGAGGCAAGGTGG + Intronic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1006728506 6:36217486-36217508 CTTTATCTGAAGAGGCAAGGTGG + Intronic
1007094576 6:39205392-39205414 CCTCATCTTCTCAGGGAAGGTGG + Intronic
1007426074 6:41747029-41747051 CCCCATCTGATGAGGAAAGATGG - Intronic
1009810516 6:68657520-68657542 CCTCCTCTGCAGGTGATAGGTGG + Intronic
1012807591 6:103914631-103914653 CCTCATCTTCAGCAGAGAGGTGG - Intergenic
1014747716 6:125219428-125219450 CCACATCTGCAGTGGAAAAAAGG + Intronic
1014888171 6:126807835-126807857 GCACATGTGCAGAGGAATGGAGG - Intergenic
1015565176 6:134562860-134562882 CCTCAATTGCAGAGGGCAGGTGG - Intergenic
1016916592 6:149249717-149249739 ACGCATCTGCACAGGAAAGCGGG - Intronic
1017233411 6:152096047-152096069 CCTCATCTGCAGGGAAGAGATGG + Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019639643 7:2096639-2096661 GCTCCTCGGCAGAGGACAGGAGG + Intronic
1021189500 7:17603288-17603310 GCTCAGCTGCAGGAGAAAGGGGG - Intergenic
1022248803 7:28586478-28586500 CTTCAGCTGGAGAGGGAAGGGGG - Intronic
1022456695 7:30564245-30564267 CCTCTTCTGCAGAGAGAAGGTGG - Intergenic
1025117085 7:56267630-56267652 TCACATCTACAGAGGATAGGAGG - Intergenic
1025244884 7:57309385-57309407 CCTCATCTGTAAAGCAGAGGTGG - Intergenic
1027835205 7:83232876-83232898 CCTCATAAGAAGAGGAAATGTGG + Intergenic
1028589263 7:92479052-92479074 CCCCATGTGCAGTGGAAAAGTGG - Intergenic
1029301251 7:99583737-99583759 CCTGATCTCCAGGGGAAAAGAGG - Intronic
1031415787 7:121495171-121495193 CCTCATCTGTAGCAGAGAGGGGG + Intergenic
1032075163 7:128832612-128832634 CCTCCTCTGCTGAGCCAAGGGGG - Intronic
1033279188 7:139993768-139993790 CCTAAGCTGCACAGCAAAGGAGG - Intronic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1034539647 7:151748796-151748818 CGTCATCAGCAGCGGCAAGGAGG + Intronic
1034696367 7:153057678-153057700 CCTCACCTGGAGAGGAAATGTGG + Intergenic
1034902667 7:154916855-154916877 CCTCCTCTGCTGTGGAAGGGAGG + Intergenic
1035740515 8:1924775-1924797 GCTGATCTGAAGACGAAAGGGGG - Intronic
1037569696 8:20147918-20147940 CCTCCTCTGATGAGAAAAGGGGG + Intronic
1037829818 8:22180797-22180819 CCTCATCTGTAAAATAAAGGTGG - Intronic
1038350514 8:26771963-26771985 CCTCCTCTGCAGTGGAGGGGCGG + Intronic
1039762227 8:40590025-40590047 CCTCATCTAAAAAGGAAGGGAGG - Intronic
1040044300 8:42946248-42946270 CCTCAGCTGCAGCTTAAAGGGGG + Intronic
1040662928 8:49596532-49596554 CCTCATGTGCACTGGAAGGGTGG + Intergenic
1042740319 8:72036339-72036361 GCTCATCTGCAGTGGCAATGTGG - Exonic
1044189307 8:89296155-89296177 CCTCATCTGCAGCGCAAGTGGGG + Intergenic
1044544635 8:93445943-93445965 TCTCAGCTGCAAAGGAAGGGAGG - Intergenic
1045926326 8:107581664-107581686 CCTAATATCCAGAGGAAAAGAGG + Intergenic
1048331947 8:133476595-133476617 TGTCATCTGCAAAGAAAAGGAGG + Exonic
1048973089 8:139656093-139656115 CCTCATGGGCACAGCAAAGGAGG + Intronic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049603123 8:143517286-143517308 CCTCAGGTGCAGGGGAAGGGAGG + Intronic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1054809741 9:69425399-69425421 CCTCACCCTCAGAGGAAGGGAGG - Intergenic
1055401816 9:75932362-75932384 CCCTATCTGCAAAGGAAGGGTGG - Exonic
1055554814 9:77463215-77463237 CCTCATCCAGAGAGCAAAGGAGG - Intronic
1056804769 9:89720047-89720069 CCACATCATTAGAGGAAAGGAGG + Intergenic
1056807955 9:89743424-89743446 CCTCACCTGCAGAGCCCAGGAGG + Intergenic
1057264255 9:93603618-93603640 CGTCATCTGCAGATTCAAGGGGG + Intronic
1057825460 9:98369346-98369368 CCTCATCTGGAGAGGACAGGGGG + Intronic
1057857645 9:98614121-98614143 CCACATCAGCAGAGGAAAAAGGG + Intronic
1058677608 9:107413804-107413826 AGTCAGCAGCAGAGGAAAGGGGG - Intergenic
1058712862 9:107696111-107696133 CAACCTCTGGAGAGGAAAGGGGG + Intergenic
1060779613 9:126401763-126401785 CCCCATGTCCAGAGGGAAGGCGG - Intronic
1061297766 9:129686270-129686292 CCTCAGGAGCAGAGGCAAGGAGG + Intronic
1061645757 9:131999800-131999822 TCACATCTGTACAGGAAAGGAGG + Intronic
1185836634 X:3350783-3350805 CCACATTTCTAGAGGAAAGGGGG - Intergenic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1190281707 X:48935355-48935377 CCTCATGTGGAAAGCAAAGGGGG - Intronic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1191722782 X:64248624-64248646 CCACACTGGCAGAGGAAAGGAGG + Intergenic
1194889127 X:99355532-99355554 CCTCGTGTGCAGTGGAAAAGTGG - Intergenic