ID: 1075596181

View in Genome Browser
Species Human (GRCh38)
Location 10:123731001-123731023
Sequence AACCCACTGCTTTCACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075596177_1075596181 30 Left 1075596177 10:123730948-123730970 CCTTCCTTGCACTATATAGTCAG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1075596181 10:123731001-123731023 AACCCACTGCTTTCACAAACAGG No data
1075596179_1075596181 -4 Left 1075596179 10:123730982-123731004 CCTGTATCACCTGACTCAAAACC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1075596181 10:123731001-123731023 AACCCACTGCTTTCACAAACAGG No data
1075596178_1075596181 26 Left 1075596178 10:123730952-123730974 CCTTGCACTATATAGTCAGTCTC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1075596181 10:123731001-123731023 AACCCACTGCTTTCACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075596181 Original CRISPR AACCCACTGCTTTCACAAAC AGG Intronic
No off target data available for this crispr