ID: 1075596735

View in Genome Browser
Species Human (GRCh38)
Location 10:123736971-123736993
Sequence TGCCCACTGCGGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075596735 Original CRISPR TGCCCACTGCGGAAGGTGGG AGG (reversed) Intronic
900228894 1:1546038-1546060 TGGCCACTGTGGATGGTGGGAGG - Intronic
900657062 1:3763616-3763638 GGGCCACTGCGGCAGCTGGGAGG - Intronic
903223911 1:21884488-21884510 TGAGCGCTGCGGGAGGTGGGAGG - Intronic
904678986 1:32215785-32215807 TGCCCTCTGCAGGAGGTGGAAGG - Exonic
905042067 1:34968109-34968131 TGCCCAGTCTGGAAGGTGAGGGG - Intergenic
905797532 1:40824032-40824054 TGCCCACTGGGTGAGGGGGGTGG + Intronic
905943754 1:41884800-41884822 TGCCAAGTGGGGCAGGTGGGTGG - Intronic
906008905 1:42504261-42504283 TGCCCACGCTGGAAGGTGGTGGG - Intronic
906211055 1:44012418-44012440 TGCCCTCTGTGGAGGGTGTGAGG - Intronic
906740163 1:48174470-48174492 CACCCCCTGCGGGAGGTGGGGGG + Intergenic
907191156 1:52650090-52650112 AGCCTTCTGTGGAAGGTGGGAGG - Intronic
907393139 1:54171724-54171746 TGCCCACTGCGTGTTGTGGGAGG - Intronic
910412634 1:86963750-86963772 TGCCCCGTCCGGGAGGTGGGGGG - Intronic
910815688 1:91289007-91289029 TGCCCCATCCGGGAGGTGGGGGG - Intronic
910891624 1:92026033-92026055 CGCCCTGTCCGGAAGGTGGGGGG - Intergenic
911067836 1:93807489-93807511 TGAGCTCTGCGGAAGGTGGTGGG + Intronic
912429798 1:109623083-109623105 CGCCCACTGAGGACAGTGGGAGG - Intronic
914908934 1:151769249-151769271 CGCCCCCTCCGGGAGGTGGGGGG - Intronic
914908975 1:151769336-151769358 TGCCCCGTCCGGGAGGTGGGGGG - Intronic
915529837 1:156497063-156497085 TTCCCAGTGGGGAAGCTGGGGGG - Intronic
915776945 1:158500772-158500794 TCACCAGTGCTGAAGGTGGGAGG - Intergenic
915861601 1:159450005-159450027 TGCCCTGTCCGGGAGGTGGGGGG + Intergenic
916037422 1:160933558-160933580 CGCCCTGTGTGGAAGGTGGGGGG + Intergenic
918414472 1:184292295-184292317 TGCGCAATGAGGAAAGTGGGAGG - Intergenic
918662490 1:187106687-187106709 GGCCTACTGGGGAGGGTGGGAGG - Intergenic
919223453 1:194661914-194661936 TGCCCACAGGAGAAAGTGGGAGG + Intergenic
920362799 1:205430782-205430804 GCCCCACTGCGGAGGGAGGGCGG - Intronic
924451887 1:244186037-244186059 TGCTCACTGAGGAAGGTGACAGG + Intergenic
1065055501 10:21838029-21838051 TGCCCCGTCCGGGAGGTGGGGGG + Intronic
1065919020 10:30374653-30374675 TGCCCACTCCGGGAGAGGGGAGG + Intergenic
1067568656 10:47355875-47355897 TGCCCACTGGGGTTGGTGAGGGG - Intronic
1070766483 10:79059490-79059512 TGCCCACTGCGGGAGGGGCTAGG + Intergenic
1070812698 10:79306295-79306317 TGCCCCCTGGGGGAGGCGGGAGG - Exonic
1071509172 10:86250584-86250606 TGCCCAGTCTGGGAGGTGGGGGG + Intronic
1072641039 10:97211474-97211496 CGCCCACTGCGGGAAGTGGAGGG - Intronic
1073300871 10:102470393-102470415 TGCCCACTTCTCAAGGTTGGGGG - Intronic
1075596735 10:123736971-123736993 TGCCCACTGCGGAAGGTGGGAGG - Intronic
1075836131 10:125454453-125454475 TGCTCAGAGCGGGAGGTGGGAGG - Intergenic
1076485475 10:130812972-130812994 TCCCTGATGCGGAAGGTGGGAGG - Intergenic
1077191604 11:1258082-1258104 TGCACACTGCGGGAGGATGGAGG - Exonic
1078069696 11:8100438-8100460 TACCTACTGGAGAAGGTGGGGGG - Intronic
1078122450 11:8523643-8523665 TGCCCAGTCCGGGAGGTGGGGGG + Intronic
1078357689 11:10644660-10644682 TTCTCACTGGGGAAGCTGGGGGG + Intronic
1081568921 11:44277680-44277702 TGCACACTGGGGAAGCTGAGAGG + Intronic
1081651235 11:44825469-44825491 CGCACACTGCAGAAGGTGGCAGG - Intronic
1082166358 11:48955506-48955528 CGCCCAGTTCGGGAGGTGGGGGG - Intergenic
1083504995 11:63148399-63148421 TTTCCACTGCAGAAGGTGGAGGG + Intronic
1084274145 11:68043231-68043253 TGCCCACAGGGGAAGGCAGGAGG - Intronic
1084327496 11:68410200-68410222 TGCCAACTGGGCAAGGTGGCAGG + Intronic
1085288361 11:75378993-75379015 TGCCCCGTCCGGGAGGTGGGGGG - Intergenic
1085918833 11:80926631-80926653 TGCCCACTGGTTAAGGTGGAAGG - Intergenic
1086458869 11:86985790-86985812 TGCGCACTGGGGGAGGTGAGTGG + Intergenic
1088761703 11:112935560-112935582 TGCCCTCTCCTGAAGGTGGTTGG + Intergenic
1089528607 11:119112619-119112641 TGACCCCTGGGGTAGGTGGGAGG + Intronic
1090226111 11:125073195-125073217 TGCCCACGGGAGCAGGTGGGAGG + Intronic
1090239319 11:125170955-125170977 TGCCCAGTGGGGGAGGGGGGAGG + Intronic
1091634669 12:2187818-2187840 TGCCTGCAGCAGAAGGTGGGGGG + Intronic
1091823653 12:3493571-3493593 TGCACACTGCGGAACCTGGCAGG - Intronic
1094000184 12:25686528-25686550 AGCCCACTGCGGGGAGTGGGGGG - Intergenic
1094124479 12:27008854-27008876 TGAAGACTGAGGAAGGTGGGAGG + Intronic
1096041352 12:48520395-48520417 TGCCCCGTCCGGGAGGTGGGGGG - Intronic
1096595585 12:52692976-52692998 TGACCACAGTGCAAGGTGGGTGG - Intronic
1097282383 12:57852897-57852919 TGCCCACTGCCGGAGCAGGGAGG - Intergenic
1098333093 12:69375050-69375072 CGCCCCCTCCGGGAGGTGGGGGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1106434328 13:29710491-29710513 TGCCCCATGTGGAAGGTGGTTGG + Intergenic
1106714483 13:32373792-32373814 TCCCCACTGAGGACTGTGGGAGG + Intronic
1108324052 13:49312932-49312954 GGCACACTGCTGGAGGTGGGAGG - Intronic
1108610130 13:52077218-52077240 TGCCCACTGCTGGAGAGGGGTGG - Intronic
1110305771 13:73985034-73985056 TGCGCACTGGGGAAGGTGGGTGG - Intronic
1111362623 13:87195116-87195138 TGCCCACTCTGGAAGGTTGTGGG + Intergenic
1111891019 13:94082588-94082610 TGGGCCCTGCGGAAGGTGGGTGG - Intronic
1112077190 13:95928216-95928238 TGCCCCGTCCGGGAGGTGGGGGG - Intronic
1112402244 13:99086836-99086858 CCCTCACTGGGGAAGGTGGGGGG + Intergenic
1113438803 13:110312696-110312718 TGATCACTGCTGAAGGTAGGAGG + Intronic
1114401919 14:22417997-22418019 TGACCAGGGTGGAAGGTGGGAGG - Intergenic
1114416009 14:22544943-22544965 AGCCCACTGAGGAAGGAGAGGGG - Intergenic
1114669665 14:24402398-24402420 TGACCACTGCGGGAGGTGATGGG + Intronic
1115622271 14:35152520-35152542 TGCCCCATCCGGGAGGTGGGAGG - Intronic
1117686070 14:58254681-58254703 TGACAACTGTGGAAGGAGGGAGG - Intronic
1118346387 14:64944235-64944257 TGTCCCCTGCTGAAGCTGGGTGG + Intronic
1122135218 14:99628852-99628874 TGCCCACTGTGAAGGGTGGCAGG + Intergenic
1123460482 15:20465897-20465919 AACCCCCTGCAGAAGGTGGGAGG + Intergenic
1123657580 15:22534519-22534541 AACCCCCTGCAGAAGGTGGGAGG - Intergenic
1124269830 15:28270395-28270417 AACCCCCTGCAGAAGGTGGGAGG + Intronic
1124311490 15:28629717-28629739 AACCCCCTGCAGAAGGTGGGAGG - Intergenic
1124411813 15:29443287-29443309 TTCCCACTGCATAAGGTGGGTGG - Intronic
1126034996 15:44537347-44537369 GACCCAGTGCGGAAGGTGGGGGG + Exonic
1126111123 15:45175328-45175350 GGGCCACCGCGGAAGGTGAGGGG - Exonic
1126571661 15:50158509-50158531 CGCCCAGTCCGGGAGGTGGGGGG + Intronic
1126767818 15:52026596-52026618 TTCCCACTGCATAAGGTGGGAGG - Intronic
1129191812 15:73941898-73941920 TGCCCAGGGAGGAAGGTGGAGGG + Intronic
1130379640 15:83360374-83360396 TGCCCACCCCGGGAGCTGGGAGG - Intergenic
1131032187 15:89195525-89195547 TGCCCCCTGCTGATGGTGTGAGG - Exonic
1132470513 16:100245-100267 TTCCCACTGCGGAAGCTTGCAGG - Intronic
1132495013 16:258744-258766 TGCCCCCTCCGGGAGGTGAGGGG - Intronic
1133178227 16:4032363-4032385 GGCCCCCTGCGGCAGGTGGAGGG + Intronic
1133332928 16:4987692-4987714 CGGCTGCTGCGGAAGGTGGGCGG + Exonic
1134750099 16:16618982-16619004 TGCCCCATCCGGGAGGTGGGGGG - Intergenic
1140314319 16:73879879-73879901 TGTCCCCTGGGGAAGGAGGGGGG + Intergenic
1140889556 16:79273240-79273262 TGACCACTGCAGAAGCTGGTGGG - Intergenic
1141698389 16:85631402-85631424 GGCCCTCTGCCGAAGGTGTGTGG + Intronic
1141792191 16:86244366-86244388 TCCCCACTGGGGAAGGAAGGCGG + Intergenic
1141797581 16:86285572-86285594 TGTCCACCCAGGAAGGTGGGTGG - Intergenic
1144541373 17:16145698-16145720 CGCCCAGTCCGGGAGGTGGGGGG + Intronic
1145060980 17:19733526-19733548 TGCCCCCAGCCGAAGGTGGGAGG - Intergenic
1146695686 17:34907676-34907698 TGCCCCATCCGGGAGGTGGGGGG + Intergenic
1146731219 17:35195066-35195088 TGCCCCGTCCGGGAGGTGGGGGG - Intergenic
1148299507 17:46534786-46534808 CGCCCCCTCCGGGAGGTGGGGGG - Intronic
1148323150 17:46769593-46769615 TGCCCAAGGAGGAAGGAGGGTGG + Intronic
1148870955 17:50658603-50658625 TGCCCACTGCGGTGGGGGGTGGG - Intronic
1149593061 17:57846321-57846343 TGCCCCGTCCGGGAGGTGGGGGG + Intronic
1149623113 17:58060799-58060821 TGTGCACTGCGGATGGAGGGGGG + Intergenic
1151498594 17:74474419-74474441 TGCCCACTAAGGAAGGGGGCAGG - Intronic
1152239421 17:79153758-79153780 AGCCCATTGCCAAAGGTGGGAGG - Intronic
1152338816 17:79713312-79713334 TGCCCACTGTGGAGGGTGTGTGG - Intergenic
1152634021 17:81423144-81423166 TGGCCTCTGCGGCGGGTGGGCGG - Intronic
1152910994 17:83004664-83004686 CGCGGACTGCGGAGGGTGGGAGG - Intronic
1152911017 17:83004750-83004772 CGCGGACTGCGGAGGGTGGGAGG - Intronic
1153304886 18:3622484-3622506 TGTCCCCTGGGGAATGTGGGAGG + Intronic
1154055950 18:11014216-11014238 TCCCCACTGAGGAATGAGGGGGG - Intronic
1154089642 18:11344845-11344867 TGCCCCATCCGGGAGGTGGGGGG + Intergenic
1154139627 18:11811380-11811402 AGCTCACAGGGGAAGGTGGGTGG - Intronic
1154171990 18:12059338-12059360 TGCCCGCGGGGGCAGGTGGGGGG - Intergenic
1154172213 18:12060534-12060556 TGCCCACTGCGGGGGGCGGTGGG + Intergenic
1155838039 18:30612241-30612263 AGCCCACTGCGTATGGGGGGTGG + Intergenic
1157455944 18:47828296-47828318 TGCCCCGTTCGGGAGGTGGGGGG + Exonic
1157551822 18:48587445-48587467 TGCCCACAGTGGTAGCTGGGAGG - Intronic
1157857714 18:51117269-51117291 TGCCCTGTCCGGGAGGTGGGGGG - Intergenic
1158474616 18:57769013-57769035 TTCCCAGTGAGTAAGGTGGGTGG + Intronic
1158646945 18:59255828-59255850 TGCCCCGTCCGGGAGGTGGGGGG + Intergenic
1159153362 18:64549867-64549889 TGTCCATTGCGGGAAGTGGGTGG + Intergenic
1160030073 18:75250126-75250148 TGACCCCTGCAGTAGGTGGGGGG + Intronic
1160665848 19:327816-327838 GGCTCACAGCTGAAGGTGGGGGG - Intronic
1160877891 19:1305890-1305912 TGGCCTCTGGGGATGGTGGGGGG - Intergenic
1161007095 19:1942140-1942162 TGGCCACAGCGGAAGGGGGAGGG - Intronic
1161057325 19:2197259-2197281 TGCCCACAGTGGAAGCTGTGTGG + Intronic
1162282678 19:9711899-9711921 TGCCCGCTCTGGAAGGTTGGGGG - Intergenic
1162450272 19:10750100-10750122 AGGTCACTGGGGAAGGTGGGAGG + Intronic
1162538174 19:11276716-11276738 CGCCCCCTCCAGAAGGTGGGGGG - Intergenic
1162683300 19:12362615-12362637 CGCCCCCTCCGGGAGGTGGGGGG + Intronic
1163112648 19:15170670-15170692 TACCCACTGCGGGACGTGCGGGG - Exonic
1163420672 19:17212066-17212088 TGCCCAGCGAGGCAGGTGGGAGG - Exonic
1164168508 19:22703001-22703023 TGCCCTGTCCGGGAGGTGGGGGG - Intergenic
1164188476 19:22894034-22894056 TGTCCGCGGCGGGAGGTGGGCGG + Intergenic
1165068470 19:33241906-33241928 TGCCCACTCCCGCAGCTGGGGGG + Intergenic
1165894512 19:39133609-39133631 TGCAGACAGCAGAAGGTGGGTGG - Intronic
927450569 2:23206043-23206065 TGGACAATGTGGAAGGTGGGTGG - Intergenic
928113302 2:28527340-28527362 TACCCAATGGGGAAGGAGGGAGG + Intronic
929650725 2:43677788-43677810 TGCCCGGTGCGGGAGGTGAGGGG - Intronic
930018519 2:46986836-46986858 TGTCCACTGTGTACGGTGGGTGG + Intronic
930590770 2:53323587-53323609 TGCCCCGTCCGGGAGGTGGGGGG - Intergenic
931718389 2:65047582-65047604 TTCCCACTGTGGAAGCTGAGAGG + Intergenic
932410251 2:71543049-71543071 TGCCCAGTCCGGGAGGTGGGGGG - Intronic
932416688 2:71577826-71577848 TGCCTCCTGGGGAAGGTGGTTGG + Intronic
934128384 2:88920722-88920744 TGCCCCGTCCGGGAGGTGGGGGG + Intergenic
934717407 2:96551822-96551844 GGGCTACTGGGGAAGGTGGGCGG - Exonic
934937844 2:98478117-98478139 TGGACACTGCCGTAGGTGGGAGG + Intronic
935402715 2:102677278-102677300 TTCCCCCTGGGGAGGGTGGGTGG - Intronic
936236299 2:110745405-110745427 TGCCCACACCAGAAGGTGGGGGG + Intronic
937044584 2:118844414-118844436 GGCCCACTGAGAAAGGAGGGAGG + Intronic
938766196 2:134461925-134461947 TCCTCACTTTGGAAGGTGGGCGG - Intronic
941225092 2:162838708-162838730 GGCCCCCTCCGGAAGGTGAGGGG - Intronic
941239487 2:163018002-163018024 AGACCAATGCAGAAGGTGGGTGG - Intergenic
941934749 2:170973927-170973949 CGCCCAGTGCGGGAGGTGCGGGG + Intergenic
943253888 2:185568127-185568149 TGTGCACTGGGGAAAGTGGGTGG - Intergenic
943863250 2:192894347-192894369 TGCCCCGTCCGGGAGGTGGGGGG + Intergenic
945031807 2:205672074-205672096 GCCCCATTGGGGAAGGTGGGAGG + Intergenic
945864767 2:215163322-215163344 TGCCCCGTCCGGGAGGTGGGGGG - Intergenic
948052558 2:234989514-234989536 TGCCCACTGCGTAAGTAGGAAGG + Intronic
948706451 2:239796022-239796044 TGCCCCTTCCGGGAGGTGGGGGG + Intronic
1168854148 20:997191-997213 AGGCCACTGAGGAAGGAGGGAGG - Intronic
1170220573 20:13937363-13937385 TGCGCACTGGGGGAAGTGGGTGG + Intronic
1170592201 20:17779268-17779290 CGCCCCGTGCGGGAGGTGGGGGG + Intergenic
1172083317 20:32358924-32358946 TGCCCACCGCGGGAGGGGGCGGG + Intronic
1172271818 20:33659394-33659416 TGCGCACTGCAGAGGGTTGGTGG + Intronic
1172691433 20:36793237-36793259 TTCCCAATGAGGTAGGTGGGTGG - Exonic
1172923833 20:38511960-38511982 TGCCCCGTCCGGGAGGTGGGGGG - Intronic
1173837585 20:46136004-46136026 TGCTCCCTGCGGAGGGTGGGGGG + Intergenic
1174073559 20:47916069-47916091 TGCCCAGTGTGGATGGTGAGAGG + Intergenic
1175515249 20:59565967-59565989 TGCCCACTGAGGAGGGTGGGAGG - Intergenic
1175814711 20:61877368-61877390 TGCCGACAGCGGGGGGTGGGGGG - Intronic
1178346819 21:31835938-31835960 TGCCCACACCGAAAGGTTGGAGG + Intergenic
1178873114 21:36392513-36392535 TGCCCCGTCCGGGAGGTGGGGGG - Intronic
1179898125 21:44374780-44374802 TGCTCACAGCAGGAGGTGGGTGG - Intronic
1182573489 22:31256813-31256835 TGGCCACTGTGGAAGGTGCAAGG + Intronic
1182660108 22:31919122-31919144 GGGGCACTGTGGAAGGTGGGAGG - Intergenic
1183185714 22:36290642-36290664 TGCCCAGTCTGGAAGGTGAGGGG + Intronic
1183774014 22:39950851-39950873 TACCCATTGAGGAAGGTGGGGGG - Intronic
1183819512 22:40334024-40334046 TGCCCAAATCAGAAGGTGGGTGG - Exonic
1184160975 22:42697276-42697298 GGGCCAGTGCGAAAGGTGGGGGG + Intronic
1184880557 22:47301849-47301871 TGCCCACTGCAGAAGGGGCCAGG - Intergenic
1185377627 22:50489436-50489458 TGCCCCCTGAGGTAGGTGGGGGG + Exonic
1185394234 22:50578541-50578563 TTCCCACCGCGGAAGGTGGGTGG - Exonic
949898708 3:8792302-8792324 TGGTCACTGTGGAAGGTGGAAGG - Intronic
951303571 3:21028610-21028632 TGCGCACTGGGGGAAGTGGGTGG - Intergenic
952273052 3:31851443-31851465 TGCCCACAGCGGGATGAGGGAGG + Intronic
952301892 3:32110735-32110757 TGCCCACTGCCGCAGGTGCAGGG + Intronic
952508005 3:34024981-34025003 TGCATACTGGGGAAAGTGGGGGG + Intergenic
952892640 3:38053558-38053580 TGCCCCGTCCGGGAGGTGGGGGG + Intronic
953188492 3:40661165-40661187 TGCCCACTGCTGAAGGCAGTGGG - Intergenic
953440147 3:42909695-42909717 CGCCCCCTCCGGGAGGTGGGGGG - Intronic
954060343 3:48061730-48061752 CGCCCAGTCCGGGAGGTGGGGGG + Intronic
954330957 3:49890055-49890077 TGACCACTGTGGAAAGGGGGAGG + Exonic
954736752 3:52713935-52713957 TGGCCACTGAGGGTGGTGGGAGG - Intronic
955670052 3:61393575-61393597 CGCCCAGTGCAGGAGGTGGGGGG - Intergenic
957935579 3:86937457-86937479 TTCCCACTGGAAAAGGTGGGTGG - Intergenic
958548561 3:95588623-95588645 AGCCCACAGGGGAAGCTGGGGGG + Intergenic
959422774 3:106148911-106148933 AGCCCACAGCGGTGGGTGGGGGG - Intergenic
960770756 3:121190727-121190749 TGCCCCATCCGGGAGGTGGGGGG - Intronic
960960481 3:123067280-123067302 AGCCCTCTGCGGAACGTGCGGGG + Intronic
962350386 3:134651738-134651760 TGCCCTGTGGGGAAGGAGGGAGG + Intronic
963923297 3:150925884-150925906 TGCCACCTGGGGAAGGAGGGCGG + Intronic
964367144 3:155962290-155962312 TGCCCCTTCCGGGAGGTGGGGGG - Intergenic
966878424 3:184336378-184336400 TGCCCACTGCTCAGGGTGGCCGG + Intronic
967243248 3:187462229-187462251 TGCCCAGTTCTGCAGGTGGGTGG + Intergenic
968579082 4:1381389-1381411 TGCACACTGAGGCAGGTGCGGGG - Intronic
968646119 4:1741455-1741477 TGCCCAGCACAGAAGGTGGGGGG - Intronic
968667313 4:1828644-1828666 TGCCCCGTCCGGGAGGTGGGGGG - Intronic
968954324 4:3710571-3710593 AGCCCACTGCGGGGGGTGGGTGG - Intergenic
969148098 4:5141817-5141839 ATCCCACTGAGGAAGGTGGAGGG - Intronic
969428089 4:7137651-7137673 CCCACACTGCGGAAGGTTGGAGG + Intergenic
971594758 4:28514784-28514806 TGCCCCATCCGGGAGGTGGGGGG - Intergenic
971796429 4:31234629-31234651 TGCTCACTGGGGAAAGTGGGTGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972271211 4:37512088-37512110 TGGCCACTGCTGAAGGATGGGGG + Intronic
972691959 4:41407623-41407645 TGCCCTCTGCGGAAGGTGCCAGG + Intronic
973626607 4:52778798-52778820 TCCCCAATGCTGGAGGTGGGAGG - Intergenic
976216732 4:82721999-82722021 TGCACACTGGGGACAGTGGGTGG + Intronic
976218906 4:82740377-82740399 TGTCCACTGGGGCAGGTGGACGG + Intronic
977368397 4:96102187-96102209 TCCCCACTGTGGAGGGAGGGAGG + Intergenic
979273754 4:118792296-118792318 TGCCCCGTCCGGGAGGTGGGGGG + Intronic
979417357 4:120460391-120460413 AGACCAATGCAGAAGGTGGGTGG + Intergenic
983552743 4:169033881-169033903 TGCGCACTGGGGGAAGTGGGTGG - Intergenic
984721310 4:182975626-182975648 CATCCACCGCGGAAGGTGGGGGG - Intergenic
985788844 5:1914657-1914679 AGGCTGCTGCGGAAGGTGGGGGG + Intergenic
988157306 5:27472206-27472228 TGCTCACTGGGGCAAGTGGGTGG + Intergenic
988936791 5:36091550-36091572 TCCCCAATGCTGGAGGTGGGAGG + Intergenic
989372357 5:40722843-40722865 TGCCCCGTCCGGGAGGTGGGGGG + Intronic
990431339 5:55738011-55738033 CGCCCACTGCGTCAGGTGCGTGG - Exonic
990988749 5:61664640-61664662 TTCCAAATGGGGAAGGTGGGTGG + Intronic
993934775 5:93986387-93986409 TGCCCCCTCTGGGAGGTGGGGGG + Intronic
998060128 5:139112703-139112725 CGCCCCGTGCGGGAGGTGGGGGG + Intronic
998259590 5:140619392-140619414 TGGGCACGGAGGAAGGTGGGGGG + Intergenic
998943022 5:147305371-147305393 TGCGCACTGAGGGAAGTGGGTGG - Intronic
999859819 5:155633461-155633483 TGCCCACTCCACAAAGTGGGAGG - Intergenic
1000005030 5:157175559-157175581 AGCCCACAGGGGAAGGTGGGTGG + Intronic
1000601532 5:163281278-163281300 TGCCCAATGTTGGAGGTGGGAGG + Intergenic
1002839837 6:896252-896274 TGCACACAGCAAAAGGTGGGGGG - Intergenic
1003121271 6:3320640-3320662 AGCCCACTGCAGCAGATGGGAGG + Intronic
1003557799 6:7156504-7156526 GGCTCAGTGCGGAAGGTGGCTGG - Intronic
1004250342 6:14018272-14018294 AGCCCACGGCGGGGGGTGGGGGG - Intergenic
1004400948 6:15288248-15288270 TGCTCATGGCAGAAGGTGGGAGG + Intronic
1005710936 6:28502444-28502466 CGCCCAGTCCGGGAGGTGGGGGG + Intergenic
1007093784 6:39200910-39200932 TGCCCATGTCTGAAGGTGGGTGG - Intronic
1007544964 6:42686709-42686731 TGCCCCGTCCGGGAGGTGGGGGG - Intronic
1007544982 6:42686751-42686773 CGCCCAGTCCGGGAGGTGGGGGG - Intronic
1007651497 6:43425313-43425335 TGCCCCGTCCGGGAGGTGGGGGG + Intergenic
1007790181 6:44304265-44304287 TGCCCAGTTCAGCAGGTGGGTGG + Exonic
1008362775 6:50641441-50641463 TGTCCACTGCTGTAGGTGGGTGG - Intergenic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1009913722 6:69966176-69966198 TGCCCCGTGCGGGAGGTGGGGGG + Intronic
1012588650 6:100952102-100952124 TGCTCTCTCTGGAAGGTGGGTGG + Intergenic
1016885960 6:148959884-148959906 TGCCCACTGCAGGGGGTGTGAGG + Intronic
1017215009 6:151899213-151899235 TGCCCAGTCCGGGAGGTGAGGGG - Intronic
1017215105 6:151899437-151899459 TGCCCAGTCCGGGAGGTGAGGGG - Intronic
1017524479 6:155230468-155230490 TGACCAGTGCCGAAAGTGGGGGG - Intronic
1017933311 6:158979798-158979820 TTCACTCTGAGGAAGGTGGGTGG + Intronic
1019055577 6:169220717-169220739 TCCCCACTGTGGAAGCTGCGTGG + Intronic
1019163169 6:170082302-170082324 ACCCCACAGCAGAAGGTGGGAGG - Intergenic
1019505537 7:1388690-1388712 TGCACACTGGGGCAGGTGAGAGG - Intergenic
1019559150 7:1647424-1647446 TGGCCTCTGAGGAAGCTGGGAGG - Intergenic
1021404335 7:20246750-20246772 TGCCCTTTAGGGAAGGTGGGAGG + Intergenic
1021735420 7:23636928-23636950 TGCCCAGTCCGGGAGGTGAGGGG + Intronic
1022704816 7:32792407-32792429 TGTTCACTGCTGAAGCTGGGTGG + Intergenic
1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG + Intronic
1027826770 7:83125292-83125314 CGCCCCCTCTGGAAGGTGGGGGG + Intronic
1028175918 7:87657897-87657919 CTCCCACAGGGGAAGGTGGGAGG - Intronic
1029372249 7:100157454-100157476 TGCTCACTGCGGGAGGGGGTGGG + Exonic
1034162517 7:149003766-149003788 TGAGGTCTGCGGAAGGTGGGAGG - Exonic
1034821478 7:154220413-154220435 AGCTAACTGGGGAAGGTGGGAGG + Intronic
1037134551 8:15445912-15445934 CGCCCCGTCCGGAAGGTGGGGGG - Intronic
1038167964 8:25103164-25103186 CGCCCCGTGCGGGAGGTGGGGGG + Intergenic
1039650808 8:39339024-39339046 TGCCCCGTCCGGGAGGTGGGGGG - Intergenic
1039753143 8:40496414-40496436 TGCCCTGTCCGGGAGGTGGGGGG - Intergenic
1040644137 8:49378830-49378852 TGCACACTGGGGGAAGTGGGTGG - Intergenic
1043915871 8:85921540-85921562 TCCCCAGTGTGGGAGGTGGGAGG + Intergenic
1047329921 8:123877525-123877547 TGCCCACTGCTGAAGGTGTTTGG - Intronic
1048573371 8:135672611-135672633 TGCCAACAAAGGAAGGTGGGTGG + Intergenic
1048979017 8:139693146-139693168 AGCCCACTCAGGAAGGTGAGAGG - Intronic
1049004525 8:139846297-139846319 TGCCTGCTGCGGGGGGTGGGGGG - Intronic
1049164254 8:141116755-141116777 TGTCCAGTGGGTAAGGTGGGCGG + Intergenic
1049586715 8:143435787-143435809 GGGCCACTGCGGGAGGTGGATGG - Intergenic
1049657293 8:143804518-143804540 TGCCCACAGCTGAAGCTGGGTGG + Intronic
1056097886 9:83273034-83273056 TGCCCCGTCCGGGAGGTGGGGGG + Intronic
1056849717 9:90072333-90072355 TTGCCACTTCGGAAGGTGGAAGG - Intergenic
1057230363 9:93317926-93317948 TGCCCACAGCAGGCGGTGGGGGG - Exonic
1057727563 9:97578921-97578943 TGCTAACTGGGGAGGGTGGGTGG + Intronic
1057884849 9:98822475-98822497 GGCCCACTGCTGGAGTTGGGTGG + Intronic
1058641381 9:107088860-107088882 TGCCCAGTGGGGAGGGAGGGGGG - Intergenic
1059560732 9:115332418-115332440 TGGAGACTCCGGAAGGTGGGAGG - Intronic
1059879802 9:118677930-118677952 TGCCCCGTCCGGGAGGTGGGGGG - Intergenic
1061831677 9:133300195-133300217 TGCCCCGTCCGGGAGGTGGGGGG + Intergenic
1062033090 9:134370897-134370919 GGGCCATCGCGGAAGGTGGGTGG + Intronic
1062666624 9:137676743-137676765 TGCGCACTGGGGGAAGTGGGTGG + Intronic
1188086480 X:25906151-25906173 TGCCCCGTCCGGGAGGTGGGGGG + Intergenic
1188865691 X:35310710-35310732 TGCCCACTCTGGAAGGTTGTGGG - Intergenic
1189837983 X:45041262-45041284 TGCCCAGTCCGGGAGGTGAGGGG - Intronic
1190769681 X:53504347-53504369 TGCCCCGTCCGGGAGGTGGGGGG + Intergenic
1191894166 X:65975298-65975320 TGCCCCGTCCGGGAGGTGGGGGG - Intergenic
1195939129 X:110152909-110152931 TGTGCACTGGGGAAGATGGGGGG - Intronic
1198108618 X:133483838-133483860 CGCCCAGTCCGGGAGGTGGGGGG - Intergenic