ID: 1075596846

View in Genome Browser
Species Human (GRCh38)
Location 10:123738081-123738103
Sequence CAGGAGAAAGAGAGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075596846_1075596853 -1 Left 1075596846 10:123738081-123738103 CCCCCTGCCCTCTCTTTCTCCTG No data
Right 1075596853 10:123738103-123738125 GCTCCAGCCATGTGAAGTGCTGG 0: 17
1: 37
2: 81
3: 123
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075596846 Original CRISPR CAGGAGAAAGAGAGGGCAGG GGG (reversed) Intronic
No off target data available for this crispr