ID: 1075597435

View in Genome Browser
Species Human (GRCh38)
Location 10:123742323-123742345
Sequence TGTCCTCTGTATACACCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075597432_1075597435 0 Left 1075597432 10:123742300-123742322 CCTCAGCTCTAAAGACCTGCCAT 0: 1
1: 0
2: 2
3: 9
4: 172
Right 1075597435 10:123742323-123742345 TGTCCTCTGTATACACCAGAAGG No data
1075597428_1075597435 19 Left 1075597428 10:123742281-123742303 CCTTGACCTCATGGCTGCCCCTC 0: 1
1: 0
2: 2
3: 30
4: 345
Right 1075597435 10:123742323-123742345 TGTCCTCTGTATACACCAGAAGG No data
1075597430_1075597435 2 Left 1075597430 10:123742298-123742320 CCCCTCAGCTCTAAAGACCTGCC 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1075597435 10:123742323-123742345 TGTCCTCTGTATACACCAGAAGG No data
1075597426_1075597435 27 Left 1075597426 10:123742273-123742295 CCCAGGCTCCTTGACCTCATGGC 0: 1
1: 1
2: 2
3: 17
4: 239
Right 1075597435 10:123742323-123742345 TGTCCTCTGTATACACCAGAAGG No data
1075597427_1075597435 26 Left 1075597427 10:123742274-123742296 CCAGGCTCCTTGACCTCATGGCT 0: 1
1: 0
2: 5
3: 27
4: 286
Right 1075597435 10:123742323-123742345 TGTCCTCTGTATACACCAGAAGG No data
1075597431_1075597435 1 Left 1075597431 10:123742299-123742321 CCCTCAGCTCTAAAGACCTGCCA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1075597435 10:123742323-123742345 TGTCCTCTGTATACACCAGAAGG No data
1075597429_1075597435 13 Left 1075597429 10:123742287-123742309 CCTCATGGCTGCCCCTCAGCTCT 0: 1
1: 0
2: 5
3: 49
4: 388
Right 1075597435 10:123742323-123742345 TGTCCTCTGTATACACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075597435 Original CRISPR TGTCCTCTGTATACACCAGA AGG Intronic
No off target data available for this crispr