ID: 1075598807

View in Genome Browser
Species Human (GRCh38)
Location 10:123752141-123752163
Sequence GCATGAAAGGCTGTGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075598807_1075598809 3 Left 1075598807 10:123752141-123752163 CCACATCACACAGCCTTTCATGC 0: 1
1: 0
2: 1
3: 16
4: 273
Right 1075598809 10:123752167-123752189 ATGATCGCCAACACTCTGCGTGG No data
1075598807_1075598811 10 Left 1075598807 10:123752141-123752163 CCACATCACACAGCCTTTCATGC 0: 1
1: 0
2: 1
3: 16
4: 273
Right 1075598811 10:123752174-123752196 CCAACACTCTGCGTGGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075598807 Original CRISPR GCATGAAAGGCTGTGTGATG TGG (reversed) Intronic
900363308 1:2300261-2300283 GCCTGAAGGGCTTTGGGATGGGG + Intronic
900673195 1:3868563-3868585 GCATGTCATGCTATGTGATGAGG - Intronic
901449527 1:9327461-9327483 CCAGGAAAGGCTGTGCCATGGGG + Intronic
903656084 1:24949690-24949712 GGATGATAGGCTGGGTGAGGTGG - Intronic
904617648 1:31758587-31758609 GCATGAAGGGATGTGGGATCTGG - Intronic
904947979 1:34213258-34213280 GCAGGGAAGGTTCTGTGATGGGG - Intronic
904961484 1:34336586-34336608 GAATGAAAGGCCATGAGATGAGG - Intergenic
905576364 1:39047954-39047976 TCATGCAAGGATGAGTGATGCGG + Intergenic
905652018 1:39662889-39662911 GCCTGAAAGCCTGAGTGGTGGGG - Intronic
907882122 1:58560326-58560348 ACATGAAAGGCTGGGTGTGGTGG + Intergenic
908081765 1:60588364-60588386 TCATGAGAGGCTTTGTAATGTGG - Intergenic
908928716 1:69289580-69289602 GTATGAAAGGCTGGGTGCTGTGG - Intergenic
909471250 1:76030871-76030893 ATATGAAAAGCTGTGTCATGTGG + Intergenic
909607176 1:77519257-77519279 CCATGATAGGCTCTGTAATGAGG + Intronic
910776878 1:90885873-90885895 GCTTGAAAGGTGGTGTGATTTGG - Intergenic
911248745 1:95550431-95550453 GCATGAAATGCTGTGTGTAAAGG - Intergenic
912713577 1:111966477-111966499 GCATGAATGGGTGGGTTATGGGG - Intronic
912771397 1:112466986-112467008 ACATGAAACGCAGTGTTATGTGG + Intronic
913139326 1:115924980-115925002 GAGTGAAATGTTGTGTGATGCGG + Intergenic
913193064 1:116429955-116429977 GAATGAATGGATGTGTGTTGAGG + Intergenic
913283584 1:117208160-117208182 GCAGGAAATGCTGGGAGATGAGG - Intronic
913317317 1:117564022-117564044 GCATGCCAGGGTATGTGATGAGG + Intergenic
914222172 1:145691089-145691111 CCATTAATGGCTGTGTGGTGGGG - Intronic
915183505 1:154083856-154083878 GGATGAAAGGGTGGGGGATGAGG + Intronic
918469515 1:184857027-184857049 AAAGGAAATGCTGTGTGATGAGG - Intronic
918907078 1:190510628-190510650 GGATATAAGGCTGTGTGCTGTGG + Intergenic
921080550 1:211735699-211735721 TGATGAAAGGATGTGTGCTGTGG + Intergenic
921282930 1:213585284-213585306 GAGGGAAAGTCTGTGTGATGAGG - Intergenic
1064219117 10:13424638-13424660 ACAGGAAAGGCTGGGTGAGGTGG + Intergenic
1064264199 10:13811725-13811747 GGAGGAAAGGCTGTCTGATGCGG + Intronic
1064551011 10:16500847-16500869 ACTTGAAAGGCTGAGTGAGGAGG - Intronic
1065695310 10:28374306-28374328 GCAGGAAGGGCTGTGGGGTGAGG - Intergenic
1069792483 10:71031838-71031860 GCATGGCAGGCTGAGTGATGGGG + Intergenic
1070798110 10:79228895-79228917 TCATGAGAGGCTGGGAGATGAGG - Intronic
1075598807 10:123752141-123752163 GCATGAAAGGCTGTGTGATGTGG - Intronic
1076786513 10:132752418-132752440 GCATGGAGGGGCGTGTGATGTGG + Intronic
1076985613 11:233926-233948 GTCTGAAATGCTGTGTGAAGTGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077487527 11:2845939-2845961 GCTTCAAAGGCTGGGTGCTGTGG - Intronic
1079249751 11:18778886-18778908 GCATGAAATAATGTGTGATCAGG - Intronic
1080549041 11:33353209-33353231 GCATGCACTGCTGTGTGATTGGG - Exonic
1080743010 11:35083027-35083049 GGATGCAAGGCTGTGAGATGGGG + Intergenic
1081501425 11:43670309-43670331 GCATGATATGCTGGGTGCTGGGG - Intronic
1083770553 11:64864566-64864588 CCATAAAAGGCTGTGGGCTGCGG - Intronic
1084766612 11:71313285-71313307 GCCAGAAAGGCTCTGTGATTTGG + Intergenic
1085075656 11:73589313-73589335 GCATGAAAAGCTCAGTGATATGG + Intronic
1085832605 11:79917417-79917439 GAATGAATGGCTGTAAGATGGGG - Intergenic
1086064875 11:82733687-82733709 GCACGAAAGGGTGCGTGCTGAGG + Exonic
1088046259 11:105456079-105456101 ACCTGAATAGCTGTGTGATGGGG - Intergenic
1088211995 11:107466666-107466688 CCATGAGAGACTGTGTCATGAGG - Intergenic
1088433855 11:109789059-109789081 GCAGGGAAGTCTGAGTGATGGGG - Intergenic
1088539990 11:110903551-110903573 GATTGAAGGGCTGTGTGGTGTGG + Intergenic
1088546885 11:110968257-110968279 CCATGTTAGGCTGTGTTATGTGG + Intergenic
1089256571 11:117197328-117197350 GCTTGAAGGGCTGGGAGATGAGG + Exonic
1090240446 11:125177735-125177757 GCAGGGAAGGCTGTGGGCTGTGG + Intronic
1090963703 11:131580051-131580073 GCAGGGAGGGCTGCGTGATGAGG + Intronic
1093095013 12:14961758-14961780 GCATGACAGCCCGTGTGACGTGG + Intergenic
1093311891 12:17599143-17599165 ACATGAGAGGCTGGGTGCTGTGG + Intergenic
1093414548 12:18905270-18905292 GGATGAATGGTTGTGTGAGGAGG + Intergenic
1094676246 12:32622878-32622900 GCATGATAGGCTGGGTGCAGTGG - Intronic
1097225471 12:57474738-57474760 GCTTGAAAGTGTGTGTGGTGAGG + Intronic
1098509795 12:71298309-71298331 CAATGCAATGCTGTGTGATGAGG - Intronic
1098831510 12:75370117-75370139 GGATTAAAGGCTGTCTGCTGAGG - Exonic
1098856620 12:75659944-75659966 GCATGAAAGAATGTTTTATGGGG + Intergenic
1100362097 12:93888621-93888643 GCATGCAAGGCAGGGTGGTGGGG + Intronic
1101443139 12:104718511-104718533 ACACGGAAGGCAGTGTGATGTGG - Intronic
1101848225 12:108380977-108380999 GAATCAAAGCCTGTGTGCTGGGG - Intergenic
1102894141 12:116585051-116585073 GCAGGGAGGTCTGTGTGATGAGG + Intergenic
1103756197 12:123209218-123209240 GAATTAAAGGCTGGGTGCTGTGG - Intronic
1106277380 13:28224906-28224928 GCAACAAAGGCTGAGTGAGGTGG - Intronic
1107483705 13:40806537-40806559 GCAGGAAGGGCTGGCTGATGGGG + Intronic
1107905355 13:45056529-45056551 GCAAGGAAGGCTGGGAGATGGGG - Intergenic
1108043897 13:46365013-46365035 TCATGAAAGGCTGGGTGTGGTGG + Intronic
1108380125 13:49847202-49847224 TCATGCAAGGCTCTGTGCTGTGG - Intergenic
1108380151 13:49847341-49847363 GCATGAAAGGCTATGTCTTGGGG + Intergenic
1111055168 13:82938954-82938976 GCATGCCTGGCTGTGTGCTGTGG + Intergenic
1113271797 13:108682694-108682716 GCATGGAAGGGTCAGTGATGTGG + Intronic
1116301856 14:43193088-43193110 ACATGAAAGGATGTTTGTTGCGG - Intergenic
1117270463 14:54138244-54138266 GCATAAAAGAATGTGTGATTGGG + Intergenic
1117839767 14:59847822-59847844 GCAGGAAAGGCTGTGGGTTCAGG - Intronic
1117921497 14:60729421-60729443 GAATGAAATGCTGTTTGCTGTGG + Intergenic
1117965106 14:61198971-61198993 GCTTGCAAGGCTGAGGGATGGGG + Intronic
1118026923 14:61778572-61778594 GAATGAAAGCCTGGGTGATCAGG - Intronic
1119413128 14:74449299-74449321 ACATCAAAAGTTGTGTGATGTGG + Intergenic
1121200277 14:92111110-92111132 GCCTGAAAAGCTCTGTGATCTGG + Intergenic
1121637027 14:95460948-95460970 AAATAAAAGTCTGTGTGATGGGG + Intronic
1121729493 14:96176389-96176411 GCAAGGAAGGATGGGTGATGGGG + Intergenic
1122156686 14:99754322-99754344 GCATGCCAGGCTGGGAGATGGGG - Intronic
1124160228 15:27261487-27261509 GTACGTAAGGGTGTGTGATGGGG - Intronic
1125463164 15:39925291-39925313 GCATGTGAGGGTGTGTGATGGGG - Intergenic
1126357790 15:47814503-47814525 TGTTGAAAGGCAGTGTGATGTGG - Intergenic
1127299464 15:57638686-57638708 GTATGAAATGTTTTGTGATGTGG + Intronic
1127921451 15:63497662-63497684 GGATGGAAGGCTGAGAGATGAGG - Intergenic
1128914949 15:71551458-71551480 GCTTGAAGGGCTGTGTGTTGGGG + Intronic
1130060193 15:80564101-80564123 GCATGCAAGGGTATGAGATGAGG + Intronic
1130728731 15:86467684-86467706 CCCTGAAATACTGTGTGATGAGG - Intronic
1131615948 15:94017617-94017639 GCAAAAAAGGATGTGAGATGGGG - Intergenic
1132777478 16:1603419-1603441 TTTTCAAAGGCTGTGTGATGTGG + Intronic
1134513458 16:14867581-14867603 GCCTGAAAGGCAGTGTGAAATGG + Intronic
1134701095 16:16266074-16266096 GCCTGAAAGGCAGTGTGAAATGG + Intronic
1134970732 16:18528571-18528593 GCCTGAAAGGCAGTGTGAAATGG - Intronic
1135598224 16:23759738-23759760 GCATGTAAGGCTGGGTGCAGTGG - Intergenic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1136929112 16:34403175-34403197 ACAGGAAAGGCTGGGTGAAGTGG - Intergenic
1136975462 16:35008629-35008651 ACAGGAAAGGCTGGGTGAAGTGG + Intergenic
1137588769 16:49680702-49680724 GCATGCCTGGCTGTGTGAAGTGG + Intronic
1137684302 16:50375055-50375077 GAATGACAGGCTGTGGGGTGTGG + Intergenic
1139516246 16:67454011-67454033 GCTTCAAAGGCTGTGGGTTGTGG - Intronic
1141473228 16:84253442-84253464 GGTTGATAGGCTGTGAGATGAGG - Intergenic
1141642715 16:85350583-85350605 GCTTGAAGGGGTGTGTGCTGGGG - Intergenic
1141795264 16:86268700-86268722 CCTTGAAAGGCTGTTTGCTGGGG - Intergenic
1141932281 16:87213987-87214009 CCATGGAAGGCTGTGGGCTGTGG + Intronic
1142534660 17:605836-605858 CCACAAAAGGCTGCGTGATGGGG - Intronic
1144423249 17:15116887-15116909 GCATGAAAGGCTTGGTGATGAGG + Intergenic
1144741664 17:17586615-17586637 ACATGAAACCCTGTGGGATGCGG + Intronic
1144834180 17:18148334-18148356 GCGTGAAAGTCTGTGTGTGGGGG + Intronic
1146151333 17:30475274-30475296 CCATCAAAGGCTGAGTGAGGAGG + Intergenic
1146558398 17:33847309-33847331 GGATGAAGGGCTGGGTGAGGTGG - Intronic
1146695926 17:34909171-34909193 GCTTGAATCGCTGTGTGATCTGG + Intergenic
1147475995 17:40712026-40712048 GCATAAGAGGCTGTGGGATTTGG + Intergenic
1147724882 17:42560893-42560915 GCTTGAAAGGCTGAGTGTGGAGG - Intergenic
1148805676 17:50262684-50262706 GCATTCCAGCCTGTGTGATGTGG - Intergenic
1148809665 17:50282329-50282351 GCAGGAAAGGCTGTAGGGTGGGG + Intergenic
1151813358 17:76458488-76458510 CCACGAAAGGCTGGGAGATGGGG - Intronic
1151989899 17:77567708-77567730 GCATGAAATGCTATCTCATGTGG - Intergenic
1155337574 18:24780753-24780775 ACATGAAAGTCTATGTTATGTGG - Intergenic
1159174669 18:64817042-64817064 AATTGAAAGGCTGTGTCATGGGG - Intergenic
1159329895 18:66978828-66978850 GAATGAAAGCATGTGTGGTGAGG + Intergenic
1159379733 18:67641232-67641254 TCAGGAGAGGCTGGGTGATGGGG + Intergenic
1159398324 18:67894121-67894143 GAAGGAAAGTATGTGTGATGAGG + Intergenic
1159636403 18:70810068-70810090 GCCAGAAAGTCTGTGTGAAGAGG - Intergenic
1160142333 18:76336671-76336693 GCATGAAAGGGTCTCTGACGTGG - Intergenic
1160525463 18:79533049-79533071 CCATGAGAGGCTGAGTGCTGTGG - Intergenic
1161413793 19:4133046-4133068 GCAAAAGAGGCTGTGTGAGGTGG + Intergenic
1161879371 19:6937202-6937224 GCATGTAAGGCTCTGGGAGGTGG - Intronic
1162176450 19:8833101-8833123 GAATAAAAGGGTGTATGATGTGG + Intronic
1162454374 19:10774194-10774216 GCCTGAAAGGCTGAGTCAGGAGG + Intronic
1162760203 19:12884530-12884552 GCAGGAGAGGGTGTGGGATGAGG - Exonic
1164899353 19:31905294-31905316 ACATAACAGGCTGTGGGATGTGG + Intergenic
1165138506 19:33685672-33685694 GCCTGGAAGGCTGGGGGATGAGG - Intronic
1165436131 19:35796602-35796624 GAATGAAATGCAGTGGGATGAGG - Intergenic
1166263129 19:41656968-41656990 CCATGAAAGGCTGTGCTGTGAGG + Intronic
925045958 2:773419-773441 GCATGAAAGGATGGGTCTTGGGG + Intergenic
925289582 2:2738491-2738513 GCACCAAAGGCCGTGCGATGGGG - Intergenic
927759539 2:25740255-25740277 GCATCGAAGAGTGTGTGATGTGG + Intronic
928059078 2:28091359-28091381 TCAGGAAAGGGTGTGGGATGAGG + Intronic
928129529 2:28639809-28639831 GCATGAAAGCACGTGTGATTGGG - Intronic
931546837 2:63397622-63397644 TCATAGAAGGCTGTTTGATGAGG + Intronic
931831308 2:66054349-66054371 GCATGAGTGGGAGTGTGATGAGG - Intergenic
934781245 2:96971082-96971104 GCAGGATAAGCTGTGTGGTGTGG - Intronic
935589674 2:104835108-104835130 TCATGAAGGGCTGGGAGATGTGG + Intergenic
936579493 2:113684935-113684957 GCATAAAAGGCTGTATGAACAGG + Intergenic
937436673 2:121887253-121887275 GTTTGAAAGGCTGGGTGATTTGG - Intergenic
938474408 2:131593867-131593889 GAATGAAAGGCTGGGTGCAGTGG + Intergenic
938708000 2:133950556-133950578 AAACAAAAGGCTGTGTGATGTGG + Intergenic
939153027 2:138495301-138495323 GTTTGATAGGATGTGTGATGAGG + Intergenic
940014557 2:149089997-149090019 GCATCTAAGAGTGTGTGATGGGG + Intronic
940242377 2:151577313-151577335 GAAAGACAGGCTGTGTGATCAGG - Intronic
940519593 2:154727296-154727318 GCATGAATGGCCGTGTGTGGTGG + Intronic
941397655 2:164993082-164993104 GCCTGGAGGGCTTTGTGATGTGG + Intergenic
942800619 2:179871192-179871214 GCATGAAGTGCTGTCAGATGAGG - Intergenic
943238469 2:185353619-185353641 GCATGATAGGCTGGGTGTGGTGG - Intergenic
945097304 2:206231701-206231723 GCAGGAAAGGCTGGGTGCGGTGG - Intergenic
946308117 2:218867605-218867627 CCAGGAATGGCTGTTTGATGAGG + Intronic
946879110 2:224159849-224159871 GCAAGGAAGGCTGTGTGAAATGG - Intergenic
947620008 2:231583847-231583869 GCAAGAAAGGCTGTTTATTGGGG - Intergenic
948480780 2:238249008-238249030 CCCTAAAAGGCTCTGTGATGGGG - Intronic
948700236 2:239755057-239755079 GGATGAAAGGATGTGTGAATGGG + Intergenic
948729094 2:239952209-239952231 GCATGAAGGACTGGGTGGTGAGG + Intronic
949071398 2:242027063-242027085 ATATGAAAGGATGTGTGTTGTGG - Intergenic
1169451464 20:5715534-5715556 GCAGGAAAGGCCATGTGAGGAGG + Intergenic
1171388225 20:24784661-24784683 GCATTTCAGGCTGTGTGGTGGGG - Intergenic
1173662560 20:44744733-44744755 GCAAGAAAGGCTGGGCAATGTGG + Intergenic
1173713683 20:45182176-45182198 GGATGGAAGGCTGTGTAATCAGG - Intergenic
1173821753 20:46024112-46024134 GCCTGGAATGCTGTGTGCTGTGG + Intronic
1174148698 20:48470479-48470501 ATATGAAAGGCTGTGTGTTGTGG + Intergenic
1175044389 20:56091032-56091054 GCATGCATGTGTGTGTGATGGGG - Intergenic
1178576470 21:33796605-33796627 GCATGTATGGCTGTGTGACGTGG + Intronic
1183311294 22:37111043-37111065 GCCTGAGATGCTGTGTGCTGTGG + Intergenic
1183759296 22:39800926-39800948 CCATTAAAGGCTGTTTGAAGAGG + Intronic
949158727 3:856262-856284 ATATGAAAGGGTGTGTGTTGTGG + Intergenic
949479833 3:4483090-4483112 GCAATAGAGGCTGGGTGATGTGG - Intergenic
949818865 3:8093226-8093248 GTATGCAAGACTGTGTGATATGG - Intergenic
949899033 3:8794631-8794653 GCAAGAAAGGCTGAGAGAAGGGG + Intronic
949900077 3:8806222-8806244 ACAAGAAACCCTGTGTGATGAGG - Intronic
950007287 3:9699441-9699463 GCCTGCAAGACTGTGGGATGTGG + Intronic
951399121 3:22208889-22208911 TCATGGAAGGCTTTGTAATGAGG + Intronic
952002742 3:28805671-28805693 CCATGAAAGGCTATATGAAGTGG - Intergenic
952592204 3:34969952-34969974 GCATGAGAGGAGGTATGATGAGG - Intergenic
953155366 3:40366484-40366506 ATCTGAAAGGCAGTGTGATGAGG - Intergenic
953960756 3:47264035-47264057 GCATGGGAGACTGTGTGAGGAGG - Intronic
954102004 3:48380949-48380971 ACACGAATGACTGTGTGATGAGG - Intronic
961380285 3:126492358-126492380 GCAGGAAAGGCAGTGGGAAGAGG + Intronic
963002024 3:140690791-140690813 TCTTGGAAGACTGTGTGATGAGG - Intronic
964408628 3:156376105-156376127 AAATGAAAGGCTGGGTGAGGTGG - Intronic
967302202 3:188025790-188025812 GCAAGAAAGGCAGTGTGATTGGG - Intergenic
968977263 4:3828392-3828414 GAATGGGCGGCTGTGTGATGAGG + Intergenic
969058762 4:4418413-4418435 GCAGGAAAGGCTGTGGGGTGGGG + Exonic
970863360 4:20730493-20730515 GTATAAAAGTCTGTGTGATTTGG - Intronic
975978228 4:80123547-80123569 GTATTAAAGGCTGGGTGCTGTGG - Intronic
976402360 4:84621712-84621734 GAATGAAAGGCTGGGTGCAGTGG - Intronic
978183876 4:105835380-105835402 GCATGCCTGGCTGTGTGAAGTGG - Intronic
979010898 4:115366552-115366574 GCATGCTGGGCTGTGTGAAGTGG + Intergenic
979598451 4:122559679-122559701 GCATGGAAGGCTGAGAAATGTGG - Intergenic
981752205 4:148103238-148103260 GCATGAAAGGTGGTGTGATACGG - Intronic
985257916 4:188087808-188087830 GGATGAAAGGCTGGGCGAAGTGG + Intergenic
986436689 5:7740780-7740802 GAATTAAAGGCTGTGGGATTTGG + Intronic
987496771 5:18655419-18655441 TCATCAAAGTATGTGTGATGTGG + Intergenic
987577139 5:19744390-19744412 GCAGAAAAGGCTGTGAGTTGAGG - Intronic
988282368 5:29166670-29166692 GCCTGAAAGTATGTGTGTTGTGG + Intergenic
991153670 5:63402529-63402551 GAGTGAAAGCCTCTGTGATGAGG - Intergenic
993049616 5:82911699-82911721 CCAGGAAAGGCAGTGTGACGTGG + Intergenic
994429638 5:99641778-99641800 ACCTGATAGGCTTTGTGATGAGG - Intergenic
997241270 5:132309820-132309842 GAATGGAAGGCTGTTAGATGTGG - Intronic
1000330573 5:160202049-160202071 GAATGAATGGCTGGGTGAGGTGG - Intronic
1001667957 5:173449023-173449045 GCATGAAAGGCTAGGTGACGGGG + Intergenic
1001761474 5:174211567-174211589 GAAGGAAAGGCTGTGTGTAGGGG + Intronic
1001881312 5:175246622-175246644 TCTTGAGAGGCAGTGTGATGTGG - Intergenic
1005275719 6:24215475-24215497 TCATGACAGGCTGTGTGGAGGGG + Intronic
1005358709 6:25009903-25009925 GCAGGAAAGGCCCTGTGGTGTGG + Intronic
1006456752 6:34136388-34136410 TCATGACAGGCTGTGTGCTGGGG + Intronic
1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG + Intergenic
1009802386 6:68555536-68555558 GCTTGAATGGCTGTGAGAAGTGG + Intergenic
1015767605 6:136735540-136735562 GCATGATAGGCCGGGTGAGGTGG + Intronic
1015988903 6:138914928-138914950 TGATGAAAGGCTGTGAGATTTGG - Intronic
1016505939 6:144779016-144779038 ACATGATAGTCTGTGGGATGTGG + Intronic
1016749693 6:147619076-147619098 GCAGGAAAGGCCGGGTGCTGCGG - Intronic
1017009107 6:150050767-150050789 ATATGAAAGGATGTGTGTTGTGG + Intergenic
1017013809 6:150083901-150083923 GTGTGAAGGGCTGTGTGAAGTGG + Intergenic
1017254375 6:152316432-152316454 CCATGCAGGGCTGTGTGATTTGG - Intronic
1017456199 6:154603658-154603680 CCATGAAAGGCGGTGTGACTGGG + Intergenic
1017671508 6:156773681-156773703 GCAGGAAATGCTGCGGGATGGGG + Intergenic
1017882219 6:158569889-158569911 GCATGAGAGGCTGGGTGCGGTGG - Intronic
1018545258 6:164928712-164928734 GCATTCATGGCTGTGTGAAGGGG + Intergenic
1019345702 7:529571-529593 ACATGAAAGGCCGTGTGCGGTGG - Intergenic
1019574912 7:1732857-1732879 CGGGGAAAGGCTGTGTGATGAGG + Intronic
1019927826 7:4204945-4204967 GCCTAAATGGCTGTGTGGTGAGG + Intronic
1020540300 7:9454206-9454228 TCATTAAAGGCTGGGTGAGGTGG - Intergenic
1021468916 7:20979190-20979212 GCATGCAAGTCTGTGGGCTGCGG + Intergenic
1021687297 7:23199337-23199359 GCATTAAAGGCTGGGTGTGGTGG - Intronic
1021887553 7:25154777-25154799 ACATGAGAGGCTGTGTCAAGGGG + Intronic
1022569435 7:31437172-31437194 GCTTGAAAGGCAGGGTGATGTGG - Intergenic
1022834790 7:34103110-34103132 GCTTTACAGGCTGTGGGATGGGG + Intronic
1023587293 7:41743943-41743965 GGGTGAAAGGCAGTGTGTTGCGG - Intergenic
1024304305 7:47914441-47914463 TTGTGAGAGGCTGTGTGATGAGG + Intronic
1024606028 7:51023455-51023477 GCATTCATAGCTGTGTGATGTGG - Intronic
1029926382 7:104323415-104323437 ATATGAAAGTCAGTGTGATGGGG - Intergenic
1031397803 7:121293718-121293740 GCATGAGAGACTGTGCCATGAGG - Intronic
1031406243 7:121390833-121390855 ACAGGAAAGGCTGTGTGGGGCGG + Intronic
1032518340 7:132523505-132523527 GCACGGAAGGATGGGTGATGGGG + Intronic
1035758193 8:2049926-2049948 GCATGAAAGCCTCAGGGATGTGG - Intronic
1040919461 8:52600131-52600153 CCTTGCAGGGCTGTGTGATGAGG - Intergenic
1041009630 8:53529306-53529328 ACAGGTCAGGCTGTGTGATGAGG + Intergenic
1041431919 8:57791675-57791697 ACTTGGAAGGGTGTGTGATGGGG + Intergenic
1041770953 8:61471950-61471972 GGATGGAAGCCAGTGTGATGGGG - Intronic
1041943856 8:63420236-63420258 GCATGAAATGCTGTCTGCTGAGG + Intergenic
1042483398 8:69327654-69327676 ATATGAAAGGGTGTGTGTTGTGG - Intergenic
1043538592 8:81233440-81233462 GCATGAAATGCAGAGCGATGGGG + Intergenic
1044480973 8:92687633-92687655 GCATGAAAGAGAGTGTGAAGGGG - Intergenic
1047268562 8:123331839-123331861 GCTTAAAACGATGTGTGATGCGG - Intronic
1047272746 8:123377777-123377799 GTATGAAAGGCAATATGATGTGG - Intronic
1047825057 8:128564376-128564398 GCATGAAAAGCAGAATGATGTGG - Intergenic
1048871934 8:138806384-138806406 GCAGGGAAGGGTGTGAGATGAGG + Intronic
1050013283 9:1207619-1207641 GCAAGAAAGCAGGTGTGATGGGG + Intergenic
1051676954 9:19568254-19568276 GCTGGAAAGTCTGGGTGATGGGG - Intronic
1054978857 9:71180340-71180362 GTATGATAGGCTGGGTGAAGTGG - Intronic
1055798669 9:80005793-80005815 GGAAAAAAGGCTGTATGATGGGG + Intergenic
1056480811 9:87003842-87003864 TCAAGAAAGTCTTTGTGATGTGG - Intergenic
1056909064 9:90681571-90681593 GCATGACAGGGTGTGGGAGGGGG + Intergenic
1057601338 9:96460356-96460378 CAAAGAAAGGCTGTGTGGTGTGG - Intronic
1060856442 9:126917420-126917442 GCATGTGAGGCTCTGTGATATGG + Intronic
1061750091 9:132771119-132771141 CCATGATGTGCTGTGTGATGAGG + Intronic
1185683394 X:1907347-1907369 GCAAGAAAGGGTCTTTGATGTGG + Intergenic
1185952240 X:4450052-4450074 GCAAGACAGGCTATGTGAGGGGG + Intergenic
1187003157 X:15203091-15203113 GAATGAAAGGCTGCTGGATGAGG - Intergenic
1188569250 X:31562276-31562298 GTATGAAAGGCTGTATGTAGAGG - Intronic
1189510043 X:41653255-41653277 GAATGAAAGGGTGGGAGATGAGG + Intronic
1190442123 X:50485186-50485208 GCATGAAAGTCTGTTTTTTGGGG + Intergenic
1192712882 X:73610035-73610057 GCTTGGAAGGGTGTGTGATTGGG - Intronic
1192851123 X:74957181-74957203 GCATGAAAGGCTGTTGAATTTGG - Intergenic
1195307825 X:103603130-103603152 GCTTCAGAGGCTGAGTGATGAGG + Intergenic
1195605949 X:106805375-106805397 GCATGTCAGGCTGGGTGAGGTGG - Intronic
1197063902 X:122216093-122216115 TCTTGAAAGGCTTTGGGATGGGG + Intergenic
1197310241 X:124895987-124896009 CCATGAAAGGAAGTCTGATGGGG - Exonic
1199530244 X:148838681-148838703 GGATTAAAGTTTGTGTGATGGGG + Intronic
1199594896 X:149499070-149499092 GAATGAAAGGCTGGGTGCGGTGG + Intronic
1200049789 X:153422613-153422635 GCAAGAGAGGCTGCCTGATGGGG - Intergenic
1202581107 Y:26381529-26381551 ACATGGAAGGCTGGGTGAGGTGG - Intergenic