ID: 1075600190

View in Genome Browser
Species Human (GRCh38)
Location 10:123761910-123761932
Sequence GAGGACTTCCAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 721
Summary {0: 1, 1: 1, 2: 9, 3: 89, 4: 621}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075600190_1075600203 17 Left 1075600190 10:123761910-123761932 CCCTCCTCCTTCTGGAAGTCCTC 0: 1
1: 1
2: 9
3: 89
4: 621
Right 1075600203 10:123761950-123761972 TCCGGGCGTCTGTCATGAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 63
1075600190_1075600205 24 Left 1075600190 10:123761910-123761932 CCCTCCTCCTTCTGGAAGTCCTC 0: 1
1: 1
2: 9
3: 89
4: 621
Right 1075600205 10:123761957-123761979 GTCTGTCATGAGGCGGTGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 169
1075600190_1075600201 14 Left 1075600190 10:123761910-123761932 CCCTCCTCCTTCTGGAAGTCCTC 0: 1
1: 1
2: 9
3: 89
4: 621
Right 1075600201 10:123761947-123761969 TCCTCCGGGCGTCTGTCATGAGG 0: 1
1: 0
2: 0
3: 1
4: 71
1075600190_1075600197 -1 Left 1075600190 10:123761910-123761932 CCCTCCTCCTTCTGGAAGTCCTC 0: 1
1: 1
2: 9
3: 89
4: 621
Right 1075600197 10:123761932-123761954 CCGTGTGGCACACCCTCCTCCGG 0: 1
1: 2
2: 1
3: 6
4: 95
1075600190_1075600198 0 Left 1075600190 10:123761910-123761932 CCCTCCTCCTTCTGGAAGTCCTC 0: 1
1: 1
2: 9
3: 89
4: 621
Right 1075600198 10:123761933-123761955 CGTGTGGCACACCCTCCTCCGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1075600190_1075600206 27 Left 1075600190 10:123761910-123761932 CCCTCCTCCTTCTGGAAGTCCTC 0: 1
1: 1
2: 9
3: 89
4: 621
Right 1075600206 10:123761960-123761982 TGTCATGAGGCGGTGTGTGGAGG 0: 1
1: 0
2: 2
3: 32
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075600190 Original CRISPR GAGGACTTCCAGAAGGAGGA GGG (reversed) Exonic
900002674 1:23424-23446 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
900022392 1:193949-193971 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
900142804 1:1145611-1145633 GAGGGCTCCCAGAAGGCCGAGGG + Intergenic
900152221 1:1183669-1183691 GAGGGCTGCCTGGAGGAGGAGGG - Intronic
900243687 1:1628310-1628332 GTGGACGCCAAGAAGGAGGACGG + Exonic
900534838 1:3171714-3171736 GGGTCCTTCCAGAAAGAGGAAGG - Intronic
900997772 1:6131702-6131724 GAGGACTTCCTGGAGTACGAAGG - Exonic
901688848 1:10959704-10959726 AAGGGCTTCCAGAAGCAGAAAGG + Intronic
901937472 1:12636632-12636654 GAGGACTCACACCAGGAGGATGG - Intergenic
902112754 1:14096691-14096713 GAAGGCTTCAAGAAGGAGGCAGG + Intergenic
902879950 1:19365420-19365442 GTGGATTTCCAGAAAGAGCACGG + Intronic
903294521 1:22335345-22335367 GAGGACTTCCTGGAGGAAGGGGG + Intergenic
903438726 1:23371197-23371219 AAGCACTTACAGAAGGAGGCAGG - Exonic
903517756 1:23923753-23923775 GAAGACTTCCTGGAGGAAGAAGG - Intergenic
904198758 1:28805481-28805503 TAGGTCTGCCAGGAGGAGGAGGG - Intergenic
904256095 1:29255847-29255869 TGGGACTTCCAGGAGGAAGAGGG - Intronic
904299023 1:29542209-29542231 CAGGACTTTAAGAAGAAGGATGG - Intergenic
904322363 1:29706193-29706215 GGGGGCTTCCAGAAGGGTGAGGG - Intergenic
904368795 1:30035397-30035419 GAGGGCTTCCTGAAAGAGGTGGG + Intergenic
904476526 1:30768671-30768693 GAAGGCTTCCAGGAGGAGGCGGG + Intergenic
904499252 1:30904776-30904798 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
904874406 1:33643163-33643185 GAGGACCTCCACAGGGAGGCAGG - Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904939111 1:34152453-34152475 GAGGATTTGGAGAAGGGGGATGG - Intronic
905032123 1:34892389-34892411 TGGGAGTTCCAGAAGGAGGAGGG + Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905516936 1:38568943-38568965 GAGGGCTTCCAGAAGTAAGAGGG + Intergenic
905858641 1:41331323-41331345 GAGGGCTTCCAGGAGGAAGTGGG + Intergenic
906156211 1:43615469-43615491 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
906920908 1:50063571-50063593 GAGGTCTTACAGAAAGAGGGTGG - Intronic
907049802 1:51322222-51322244 GAGGCCTTGGAGAAGGAGGAGGG - Intronic
907517525 1:55002021-55002043 AAAGACATCCAGAAGAAGGAAGG + Intronic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
908034976 1:60042052-60042074 GAGGACCTCAAGAAGGAAGAAGG - Intronic
908516836 1:64901233-64901255 GAGTACTTCTGGAAGGAGGTGGG - Intronic
908746345 1:67380342-67380364 GAAGGCTTCCTGAAGGAGGAAGG - Intronic
909346968 1:74601607-74601629 GAAGACTTCCCAAAAGAGGAAGG + Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561873 1:77016301-77016323 GAAGAGTTTCAGGAGGAGGAGGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911048417 1:93648811-93648833 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
912309168 1:108602344-108602366 CAGCACTTCCAGAGGGAGCATGG - Intronic
913171108 1:116233257-116233279 GAGGGCTTCCATAGGGATGATGG + Intergenic
913309332 1:117472183-117472205 GAGGACATAGAGAAGGCGGAAGG - Intronic
913531010 1:119734338-119734360 CAGGGCTTCCACAATGAGGAGGG - Intronic
915433827 1:155887957-155887979 GGGGACTACCAGAAGGGGGAGGG - Intergenic
915514659 1:156405851-156405873 GAAGAGTTTCAGAAAGAGGAGGG + Intronic
915535451 1:156532854-156532876 GAGAACTTCCTGAAGGATAAGGG + Intronic
915720138 1:157978807-157978829 GTGGACTTCCCGGAGCAGGAGGG - Intergenic
915896268 1:159813557-159813579 AAGGACTTCCAGCAGGATGGTGG + Intronic
916927240 1:169535017-169535039 GGGGACTTCTAGAAGGGGGAAGG + Intronic
917393092 1:174560718-174560740 AAGGACTACTAGAAGGGGGAGGG - Intronic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
917715052 1:177726562-177726584 GGGGTCTTTCAGAAGGTGGAGGG + Intergenic
917730314 1:177868580-177868602 GGGGACTACTAGAGGGAGGAGGG - Intergenic
918188513 1:182148928-182148950 GAGGACTTCCAGAGTGAAGCAGG - Intergenic
918830635 1:189392824-189392846 GTGAACTACCAGAAGGTGGAGGG + Intergenic
919459412 1:197858412-197858434 GGGGACTACTAGAGGGAGGAGGG - Intergenic
919670021 1:200329779-200329801 GAGGGCTTCCAGCAGAGGGAGGG + Intergenic
920171086 1:204073027-204073049 GGGGACTTGCAGAAGAAGGGAGG - Intergenic
920210190 1:204322374-204322396 GAGAACTTCCAGAAGGATGCCGG - Intronic
920274682 1:204795358-204795380 GAGGAGTTCTAGAAGGAAGAAGG + Intergenic
920686889 1:208116170-208116192 GAAGACTTCCTGGAGGAGGGAGG - Intronic
920848194 1:209610954-209610976 GAAGGCTTCCAGGAGGAGGTGGG + Intronic
921132504 1:212231979-212232001 GAGGACTCCCAGAGCAAGGAGGG - Intergenic
921395784 1:214667994-214668016 GAGGACTACTAGATGGGGGAAGG + Intergenic
921961266 1:221036863-221036885 GAGGCCTACCAGAGGGTGGAGGG - Intergenic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
922658585 1:227408718-227408740 GAGGACTTACTGATAGAGGAAGG - Intergenic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
923666460 1:236002712-236002734 GAGGACTTCAAGAAAAAGAAGGG + Intronic
924071551 1:240285419-240285441 GAGGAGTTCAGGAAGGAGGTCGG + Intronic
924195765 1:241605187-241605209 GAGAAATTCCAGAACGAGTAAGG + Intronic
924256893 1:242191758-242191780 CAGGACTTCAAGAAAGAAGAGGG + Intronic
924383491 1:243483465-243483487 GCGGACTTCCCAAGGGAGGAGGG - Intronic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1063355583 10:5395524-5395546 GAGGACTAGCAGCAGGTGGACGG - Intronic
1063420224 10:5906553-5906575 GAGGTCTTCCACCGGGAGGAAGG - Exonic
1063776324 10:9269158-9269180 GAGGACTACTCGAAGGTGGAGGG + Intergenic
1064892018 10:20186568-20186590 GAGGCCTACCAGAGGGCGGAGGG - Intronic
1064962116 10:20976758-20976780 GGGGACTTCAAAAGGGAGGAGGG + Intronic
1065010735 10:21418571-21418593 GAGGACGGACAGAAGGAGCAAGG - Intergenic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1067082542 10:43219673-43219695 GAGGGCCTCCAGAGGCAGGAAGG + Intronic
1067154579 10:43767126-43767148 GTGGACTACTAGAGGGAGGAAGG + Intergenic
1067840161 10:49669315-49669337 GAGAAATCCCAGAAGGAGGTGGG - Intergenic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1068262610 10:54601972-54601994 GAGGCCAACCAGAAGGTGGAGGG + Intronic
1068282016 10:54885250-54885272 AAGGGCTTCAAGAAGGGGGAAGG + Intronic
1068662347 10:59635607-59635629 GAGGACTTTCATAAGGAAGATGG + Intergenic
1069200465 10:65608718-65608740 TAGGGATTCCAAAAGGAGGAAGG + Intergenic
1069815053 10:71188451-71188473 GAGGCCTTCCAGGAGGCAGAGGG - Intergenic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1071020166 10:81044623-81044645 AGGGACTACCAGAAGGTGGAGGG - Intergenic
1071025367 10:81106906-81106928 GTGGACTGCTAGAAGGGGGAGGG + Intergenic
1071515038 10:86291557-86291579 GAGGGCTTCCTGGAGGTGGATGG - Intronic
1071666223 10:87561525-87561547 GAGGATTCCCAAAAGAAGGATGG + Intergenic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1073320078 10:102610533-102610555 GAGAACATCCAGAAGGGTGAGGG + Intronic
1073591520 10:104762160-104762182 GAGGACTTACTGGAGGAGGTGGG - Intronic
1073876338 10:107926440-107926462 GGGGACTTTCAGAGGGTGGACGG + Intergenic
1073894927 10:108144343-108144365 GGGGACTACCAGAGGGAGGAGGG - Intergenic
1074750867 10:116585902-116585924 GTAGAGTTCCAGAAGGAGCATGG - Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1076120020 10:127928487-127928509 GAGCACTTCCAAAAGAAGGAAGG - Intronic
1076334878 10:129699758-129699780 GAGGTCTTCCTGGAGAAGGACGG - Intronic
1076489222 10:130845715-130845737 GAGACATTCCAGAGGGAGGATGG + Intergenic
1076601700 10:131660916-131660938 GAGAACTTTCAGAAGGAGAGTGG + Intergenic
1076621839 10:131793991-131794013 CAGGGCTTCCAGAAGGCGAATGG - Intergenic
1076676062 10:132148442-132148464 GAGGACGGGCAGATGGAGGACGG - Intronic
1076743989 10:132503717-132503739 CAGGACTCCCAGGTGGAGGAAGG + Intergenic
1077202668 11:1319379-1319401 GAAAACTTTCAGGAGGAGGAGGG + Intergenic
1077370042 11:2177530-2177552 GGGGACTGCCTGGAGGAGGAGGG - Intergenic
1077407813 11:2390560-2390582 GAGGGCTTCTAGGAGGAGGCAGG + Intronic
1077504449 11:2923643-2923665 GAGGGCTTCCTGGAGGAGGTTGG + Intronic
1077829653 11:5852533-5852555 GAGGACTACTAGAGGGAGGAGGG - Intronic
1078478427 11:11655008-11655030 GAGGACCACAAGAAGGAGGAGGG + Intergenic
1079473169 11:20799860-20799882 GGGGACTACTAGAAGGAGGAAGG - Intronic
1079757970 11:24289794-24289816 TAGGACTTACAGAAGGAGCCTGG + Intergenic
1081259846 11:40946089-40946111 GAGGACTACTAGAGGGAGGAGGG - Intronic
1081675157 11:44964298-44964320 GAAGACTTCCTGCAGGAGGTGGG - Intergenic
1083089019 11:60180648-60180670 GAGGCCTTTCAGAGGGTGGAGGG - Intronic
1083513831 11:63237179-63237201 GTGGACTACTAGAGGGAGGAAGG + Intronic
1083954896 11:65977813-65977835 CAGGACTTCAAGGAGAAGGACGG + Exonic
1084009469 11:66339529-66339551 CAGGACTTCCAAGAGGAGGGTGG + Intronic
1084306586 11:68288755-68288777 TAGGACTTCCAGAGGAAGAAGGG + Intergenic
1084405665 11:68971424-68971446 GGGGACTTCCCGGAGGAGGCAGG - Intergenic
1085371498 11:76010915-76010937 AGGGACTTCAAGAAGCAGGATGG + Intronic
1085745747 11:79112818-79112840 GAAGACTTCCTGGAGGAGGTGGG - Intronic
1085802480 11:79603235-79603257 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1088265829 11:107986739-107986761 GGGGCCTTTCAGAAGGTGGAGGG + Intergenic
1088534284 11:110843080-110843102 GAGGCCTATCAGAAGGTGGAGGG - Intergenic
1088817057 11:113428589-113428611 GAGAACTTCCTGGAGGAGGGAGG + Intronic
1089166954 11:116484724-116484746 GGGGACTACCAGAAGAAGCAAGG + Intergenic
1089280188 11:117368669-117368691 AAGGACTCCAAGAAGGAGGTGGG - Intronic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1089803119 11:121054672-121054694 GAGGACTTCCATAAGTTGAAAGG - Intronic
1091125069 11:133087441-133087463 GGGGACTTCTAGAAGGGGGATGG - Intronic
1091294148 11:134460912-134460934 AAGGCCTTCCAGAAGCACGAAGG + Intergenic
1091376091 12:25487-25509 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
1091386418 12:98856-98878 GAGGGCGTGCAGAAGTAGGAAGG + Intronic
1092077188 12:5683805-5683827 GAGGGCTTCCTGGAGGAGGCAGG + Intronic
1093265147 12:16994558-16994580 GGGGCCTTTCAGAAGGTGGAGGG + Intergenic
1094245426 12:28286368-28286390 GGGGCCTACCAGAAGGTGGAGGG - Intronic
1094524293 12:31221512-31221534 GAGGGCTTCCAGGAAGAGGTGGG + Intergenic
1094577803 12:31703452-31703474 GGGGACTTCAAAAGGGAGGAAGG - Intronic
1094726400 12:33122061-33122083 GGGGCCTACCAGAAGGTGGAGGG + Intergenic
1094782193 12:33803557-33803579 GGGGTCTACCAGAAGGTGGAGGG - Intergenic
1095244819 12:39907688-39907710 GAGGGCTTTCTGCAGGAGGATGG - Intronic
1095902246 12:47339871-47339893 GAAGACTTCCACATGTAGGAAGG - Intergenic
1095903697 12:47355383-47355405 GGGGACTACTAGAGGGAGGAAGG - Intergenic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1098190663 12:67945167-67945189 GAAGGCTTCCTGGAGGAGGAGGG + Intergenic
1102547237 12:113665868-113665890 GAGGACATCCTGAAGGCAGAGGG - Intergenic
1102952878 12:117041939-117041961 GAGGACTTCCTGAAGGTGGGTGG - Exonic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1103057125 12:117830341-117830363 GGGGACTCCTAGAAGGGGGAGGG + Intronic
1103666320 12:122569012-122569034 GGGGCCTTTCAGAAGGTGGAGGG + Intronic
1103798757 12:123523494-123523516 GAGGAGTTCCAGAAGCATGAAGG - Exonic
1103899388 12:124295460-124295482 GAGGACAGCCTGAAGGAGCAGGG + Intronic
1104111818 12:125711335-125711357 GAGGCCACCCAGAAGGAGGTGGG + Intergenic
1104140339 12:125981777-125981799 GAGAACTTGCACAAGGGGGAGGG - Intergenic
1104391297 12:128392602-128392624 GAAGACTTCCTGGAGGAGGTGGG + Intronic
1105442875 13:20429992-20430014 GAGGAGTTCGGGGAGGAGGAGGG - Intronic
1106559171 13:30833826-30833848 GGAGACATCCAGAAGGAGGTGGG + Intergenic
1106932496 13:34682047-34682069 GAGGACTTCCAGAAAGTGTGTGG + Intergenic
1107244962 13:38282538-38282560 GGGGCCTTTCAGAAGGTGGAGGG + Intergenic
1108458447 13:50641024-50641046 GGGGACTTCTAGAGGGAGAAGGG - Intronic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1109311749 13:60703100-60703122 GGGGACTACCCGAGGGAGGAGGG - Intergenic
1109663915 13:65504722-65504744 GAAGAGTTCCAGAAGGAGATGGG - Intergenic
1109690758 13:65885035-65885057 AAGGACTTCCAGAAGGGCAAAGG + Intergenic
1110402429 13:75108919-75108941 GGGGACTTTCAGAGGGTGGAGGG + Intergenic
1111436437 13:88215931-88215953 GAGTAGTTTGAGAAGGAGGAAGG + Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1114136052 14:19852403-19852425 GGGGCCTTTCAGAGGGAGGAGGG - Intergenic
1114578569 14:23736124-23736146 GGGGACTACCAGAGGAAGGAGGG + Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115163355 14:30420363-30420385 CAGGACCTCCAGAAGTAGGCAGG + Intergenic
1115180653 14:30622194-30622216 GAGGTCTTCCTGGAGGAGGTGGG + Exonic
1116280002 14:42894505-42894527 GTGGACTACCAGAGGGTGGAGGG - Intergenic
1116787474 14:49303538-49303560 GAGGTCTTCCACAAGAAGGAAGG + Intergenic
1117622473 14:57601464-57601486 GGGGACTACTAGAGGGAGGAGGG - Intronic
1118124176 14:62881465-62881487 GGGGCCTGCCAGAAGGCGGAGGG + Intronic
1118508037 14:66436956-66436978 GAGGACTACTAGAAGAGGGAGGG - Intergenic
1119663164 14:76465734-76465756 GAGTTCTGCCTGAAGGAGGAAGG + Intronic
1120445073 14:84585269-84585291 GAAAACTACTAGAAGGAGGAGGG + Intergenic
1120544356 14:85792389-85792411 GTGGACTACAAGAAGGGGGAGGG + Intergenic
1120568262 14:86085888-86085910 GAGGGGCTCCAGAAAGAGGAGGG + Intergenic
1120673370 14:87389853-87389875 CTGGACTTCCAGAAAAAGGAAGG + Intergenic
1120780089 14:88479260-88479282 GAGGACTTCGAGGAGGAGAGCGG - Exonic
1121671623 14:95714464-95714486 GGGGTCTTCCAGAAGAAGAAAGG - Intergenic
1121682638 14:95806673-95806695 TAGGAATCCCAGAAGGAGAATGG - Intergenic
1121687496 14:95848195-95848217 GAGGAATTGCAGAGGGAGGTGGG - Intergenic
1121839015 14:97117430-97117452 GAGGACACCAAGAAGGAGCAGGG - Intergenic
1121866418 14:97366620-97366642 GAAGACTTCCTGGAGGAGGAGGG - Intergenic
1122301214 14:100732143-100732165 AAGGACTGCCAGAAAAAGGACGG + Exonic
1122854711 14:104554542-104554564 TAGGCCTTTCAGAGGGAGGAAGG - Intronic
1122941053 14:104981547-104981569 GAAGACCCCCAGAAGGAGGGTGG - Intergenic
1122977255 14:105175935-105175957 GAGGTCTTGGGGAAGGAGGAGGG - Intronic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1123023535 14:105413045-105413067 GAAGGCTTCCTGAAGGAGGAGGG - Exonic
1123784064 15:23651097-23651119 GAGGGCTTCAGGAAGCAGGAAGG - Intergenic
1125400004 15:39291930-39291952 GGGGCCTACCAGTAGGAGGAGGG - Intergenic
1125532785 15:40424439-40424461 GAGGTCTTCCTGAAGGAGGCAGG - Intronic
1125588741 15:40841169-40841191 GAGGACTACCAGAAGAGAGAAGG - Intergenic
1127426852 15:58865881-58865903 GATGACTTCCCGAGGGCGGAGGG + Intronic
1128357859 15:66941115-66941137 GAGGACTTCTGGAAGGAGGTGGG - Intergenic
1128672621 15:69585963-69585985 CAGGACTTCCAGAACATGGAGGG - Intergenic
1128705296 15:69833894-69833916 GAGGACTTCCAGGGAGAGGTGGG - Intergenic
1128729913 15:70014128-70014150 GAGGCCTTCCTGGAGGAGGACGG - Intergenic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129168920 15:73796146-73796168 GAGCGCTTCCTGGAGGAGGAAGG - Intergenic
1129253157 15:74319624-74319646 GGGGTCTTCCTGGAGGAGGAGGG + Intronic
1129707012 15:77800083-77800105 GAAGGCTTCCTGATGGAGGAGGG + Intronic
1130054555 15:80511364-80511386 GGGGACTTTCAGAGGGTGGAGGG + Intronic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1130129082 15:81121868-81121890 GGGGCCTTTCAGAAGGTGGAAGG - Intronic
1130179489 15:81610638-81610660 GGGGACTACCAGAGGGTGGAGGG + Intergenic
1130273946 15:82466812-82466834 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130397698 15:83517903-83517925 GGGGACTACTAGAAGGGGGAGGG - Intronic
1130466294 15:84194186-84194208 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130497970 15:84479350-84479372 GGGGCCCTGCAGAAGGAGGATGG - Intergenic
1130588588 15:85198779-85198801 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130857939 15:87857842-87857864 AAGGACTTCCTGAAGAAAGATGG + Intergenic
1131383762 15:91985912-91985934 GAGGCCTTCGAGGAGCAGGATGG + Intronic
1131525682 15:93150758-93150780 GAGGACTTCCACAAGGATCCAGG - Intergenic
1132450837 15:101967515-101967537 GAGGACTTTCAGGAAGAGGTGGG - Intergenic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132500650 16:283275-283297 GAGGAAATCCCCAAGGAGGATGG + Exonic
1132762924 16:1519717-1519739 GAGGGCTCCCAGGAGGAGGTGGG + Intronic
1132804331 16:1768711-1768733 GAGGACGACGAGACGGAGGAGGG + Exonic
1132887197 16:2187488-2187510 GGGGCCTTCCAGCAGGAGGCCGG + Intronic
1132984846 16:2759979-2760001 GAAGGCTTCCTGAAGGAGGTGGG + Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133088905 16:3388328-3388350 AAAGACTTGCTGAAGGAGGAGGG - Intronic
1133389860 16:5401479-5401501 GAGGACTAACGGCAGGAGGAGGG - Intergenic
1133464697 16:6018810-6018832 GGGGACTACCAGGACGAGGACGG + Intergenic
1134590530 16:15449358-15449380 GGGGACTACAAGAGGGAGGAAGG + Intronic
1134617337 16:15661738-15661760 AAAGACTTCCAGAAGGTGGCTGG - Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135534109 16:23279426-23279448 GAAAACTTACACAAGGAGGAGGG + Intronic
1136000348 16:27287785-27287807 AGGGACTTCTAGAGGGAGGATGG + Intronic
1136381857 16:29899629-29899651 GAGGAAGTGCAGATGGAGGAGGG + Intergenic
1137498415 16:48990384-48990406 GAGGACTACTAGAAGGGGAAGGG + Intergenic
1139005814 16:62570600-62570622 GAGGACATCGAGAAAGATGAAGG + Intergenic
1139138072 16:64229091-64229113 TAGGAATTCCAAAAGGTGGAGGG - Intergenic
1139475916 16:67202519-67202541 GAGGACTTCGACAAGGTGGGTGG + Exonic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139643386 16:68309955-68309977 GAAGACTTGCAGAAGGTGAATGG - Intronic
1139878379 16:70164424-70164446 AGGGACTTACAGAAGGAGCAGGG - Intergenic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141592524 16:85078075-85078097 TAAGACTTCCACAAGGAAGAGGG + Intronic
1141617404 16:85217799-85217821 GAGGGCTTCGAGGAGGAGGCAGG - Intergenic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1141656305 16:85418481-85418503 GAGGGCTTCCTGGAGGAGGCGGG - Intergenic
1141675219 16:85514111-85514133 GGGTTCTTCCAGAAGGAGGCAGG - Intergenic
1141688923 16:85585652-85585674 GAAGAGTTCCAGAACCAGGATGG - Intergenic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1142512691 17:407429-407451 GGGGACTACTAGAGGGAGGAGGG + Intergenic
1143140899 17:4741181-4741203 GAGGGCTTCCGAAGGGAGGATGG - Intronic
1143549567 17:7621731-7621753 GAGAAATTACAGAAGGAGGCTGG + Intronic
1143999988 17:11044756-11044778 GGGGACTTCTTGAAGGTGGAAGG - Intergenic
1145901468 17:28493217-28493239 GAGGACTTCCCGAAGGCTGTTGG + Intronic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146081224 17:29782478-29782500 CATGACTTCCAGAAGGAGTCTGG - Intronic
1146185195 17:30720071-30720093 GAGGGCTTCCTGGAGGAGGTGGG + Intergenic
1147568201 17:41550588-41550610 GGGGACTTCTAGGAGGGGGAGGG - Intergenic
1148155553 17:45423490-45423512 GAGTGCTTCCTGGAGGAGGAAGG - Intronic
1148508490 17:48147601-48147623 GAGATTTTCCAGAAGGAGAAAGG + Intronic
1149576739 17:57719076-57719098 GAGGACTTACAGAAGGGAAAGGG + Intergenic
1149865476 17:60149005-60149027 GAGGACCTGCAGTAGCAGGAGGG + Intergenic
1150387240 17:64772147-64772169 GAGTGCTTCCTGGAGGAGGAAGG - Intergenic
1150581667 17:66479843-66479865 GAGGCCTGTCAGAAGGTGGAGGG + Intronic
1151105412 17:71610633-71610655 GGGGACTACAAGAAGGGGGAGGG + Intergenic
1151105601 17:71612858-71612880 GGGGACTACAAGAAGGGGGAGGG + Intergenic
1151162445 17:72176694-72176716 GACTTCTGCCAGAAGGAGGATGG - Intergenic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1151675649 17:75596070-75596092 GAGCACTTCCTATAGGAGGAAGG + Intergenic
1152009763 17:77705172-77705194 AAAGACTACCAGGAGGAGGAAGG - Intergenic
1152646881 17:81473297-81473319 GAGGAGTTCGAGGAAGAGGAGGG + Intergenic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1153755254 18:8276129-8276151 GAAGACTTCAAGGAGGAGGCAGG - Intronic
1153915212 18:9738788-9738810 GAGGCCTAGCACAAGGAGGAAGG - Intronic
1154098994 18:11451055-11451077 GAGGACTACTAGAAGCAGGAAGG + Intergenic
1155280625 18:24235970-24235992 AGAGACTTCCAGATGGAGGATGG + Intronic
1155562971 18:27100246-27100268 GGGGACTTCTAGAGTGAGGAGGG + Intronic
1155958109 18:31970964-31970986 TCTGACTTTCAGAAGGAGGATGG - Intergenic
1156453626 18:37280590-37280612 GATGGCTTCCAGGAGGAGGTGGG + Intronic
1156950347 18:42888898-42888920 GTGGACTTCTGGAAGAAGGAAGG + Intronic
1157294790 18:46434810-46434832 GAGGCCTTCCTGGAGGAGGAAGG + Intronic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1158084903 18:53639637-53639659 GAGGAATGCCAAAAGGAGGGTGG - Intergenic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159254028 18:65922077-65922099 GTGAACTACCAGAAGGAGGAGGG - Intergenic
1159959064 18:74541485-74541507 GAGGAGTCACAGAAGGAGAAGGG + Intronic
1160117554 18:76095588-76095610 GAGGACTACCAGAGAGGGGAGGG + Intergenic
1160225510 18:77008348-77008370 GAGGCCTCCCAGAAGGACGGGGG + Intronic
1160225694 18:77009201-77009223 GAGGACAGCCAGGAGGAGAAGGG - Intronic
1160634425 19:65032-65054 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
1160710299 19:548359-548381 GAGGGCTTCCTGGAGGAGGTGGG + Intronic
1161701064 19:5795605-5795627 GAAGGCTTCCTGTAGGAGGAGGG + Intergenic
1162548529 19:11345609-11345631 CAGGACTGCAAGATGGAGGAAGG - Exonic
1162973585 19:14195618-14195640 GAGGGCTTCCTGAAGGAGGCGGG - Intronic
1163008776 19:14411998-14412020 GAGCACATCCTGAAGGATGAAGG - Intronic
1163057383 19:14730811-14730833 GGGGACTACTAGATGGAGGAGGG - Intronic
1163781252 19:19249876-19249898 GAGGACTGGGAGAAGGACGAAGG + Exonic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1164485277 19:28650507-28650529 GAGGACTACTACAAGGAAGATGG - Intergenic
1164541990 19:29128317-29128339 GAGGACTCACAGTGGGAGGATGG + Intergenic
1164592132 19:29512900-29512922 GAAGTCTTGGAGAAGGAGGAAGG + Intergenic
1166210290 19:41302561-41302583 GTGGCCTTCCAGAAGGGAGAAGG - Intronic
1166717034 19:44975153-44975175 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
1167672232 19:50859814-50859836 GCCGACTTCCAGAAGAAGGTGGG - Intronic
1167697555 19:51024263-51024285 CACAACCTCCAGAAGGAGGAGGG - Exonic
1167776500 19:51561103-51561125 GAGGTCTCCCTGGAGGAGGAGGG + Intergenic
925917400 2:8616448-8616470 GAGGACTTGATAAAGGAGGATGG - Intergenic
926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG + Exonic
927203996 2:20595494-20595516 GAGGGCTTCCTGGAGGAGGGAGG + Intronic
927471505 2:23380983-23381005 GATGCCTTCCTGGAGGAGGAAGG - Intergenic
927773078 2:25880491-25880513 AAGGAAATCCAGAAGGAGGGTGG - Intergenic
927849783 2:26491617-26491639 GTGGATTTTCAGCAGGAGGAAGG + Intronic
927899700 2:26810555-26810577 TAGGATTTCCAGAAGAAGGTGGG + Intergenic
927904127 2:26845235-26845257 GAGGACGTGCTGAAGCAGGAAGG + Intergenic
928063733 2:28141599-28141621 GAAGAATTCCAGAAGGAGCAAGG + Intronic
929224099 2:39495163-39495185 GAGTATTTCAAGAAGCAGGAAGG - Intergenic
929564861 2:42977960-42977982 GTGGACTTCTTGGAGGAGGAAGG + Intergenic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
930152138 2:48069910-48069932 GAAGGCATCCAGAATGAGGAAGG + Intergenic
931027443 2:58128260-58128282 CAGGACTTCCATAGTGAGGAAGG - Intronic
931317627 2:61147472-61147494 GAGGACATGCAGCAAGAGGAAGG - Intronic
931518870 2:63073431-63073453 GAGGACTACTAGAGGTAGGAGGG + Intergenic
932192411 2:69752063-69752085 GAAGGCTTCCTGGAGGAGGAAGG + Intronic
932420149 2:71596747-71596769 GAGGACTTCCTGCAGGAAAATGG - Intronic
932421134 2:71602112-71602134 CAAGACCTCCAGAAGAAGGAAGG - Intronic
933058341 2:77702626-77702648 GAGGACTACTAGAAAGAGAAGGG + Intergenic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
933796195 2:85921758-85921780 GAGAACTTGCACACGGAGGAGGG + Intergenic
934097913 2:88624682-88624704 CAGGACATCCAGAGGGAGGTAGG - Intronic
934734939 2:96685419-96685441 GAGGACTGCAAGTAGGAGTAGGG + Intergenic
934991562 2:98925183-98925205 TGGGACTTCAAGGAGGAGGAAGG + Intronic
935361889 2:102252066-102252088 GGGGACTTCAAAATGGAGGAGGG - Intergenic
935499843 2:103825361-103825383 GAGGACTTCCTGATAGGGGAGGG - Intergenic
936025321 2:109027276-109027298 GAAGACTTCTTGAAGGAGGGTGG + Intergenic
936893453 2:117399275-117399297 GTGGACTACTAGAAGGTGGAGGG + Intergenic
937148080 2:119664387-119664409 GAGGACTTCTGGAAGGTGGGGGG - Intergenic
937239280 2:120449989-120450011 GAGGGCTTCCTGAAGGAGGTGGG + Intergenic
937953979 2:127408723-127408745 GAAGACTTCCTGGAGGAGGCGGG - Intergenic
938082738 2:128378866-128378888 GCTCACTTCCAGGAGGAGGAAGG + Intergenic
938302697 2:130228285-130228307 GGGGGCTTCCCGGAGGAGGAAGG - Intergenic
938663240 2:133508318-133508340 GAGGGCTTCCCCAAGGAGGAGGG - Intronic
938934213 2:136115118-136115140 GATGATTTCCAGGAGGATGAAGG + Exonic
939045617 2:137246155-137246177 GAAGAGATCCAGGAGGAGGATGG + Intronic
939125305 2:138171142-138171164 GGGGACTACAAGAAGGAGGAAGG + Intergenic
939173622 2:138724093-138724115 GAGGCCTTTCAGAAAGTGGAGGG - Intronic
940613710 2:156024118-156024140 AAGGGCTTCCAGAAGGAAGCTGG + Intergenic
940810261 2:158234965-158234987 GGGGCCTTCCAGAGGGTGGAGGG + Intronic
941836847 2:170031678-170031700 GAGGACTACTAGAAGAGGGAAGG - Intronic
941916914 2:170818910-170818932 GAGGGCTTCGCGGAGGAGGAGGG + Intronic
943168271 2:184361193-184361215 GGGGACTTCTAAAAGGGGGATGG + Intergenic
943860355 2:192854195-192854217 GCAGACTACTAGAAGGAGGAGGG - Intergenic
943928472 2:193819486-193819508 CAGGACTACCAGTAGCAGGATGG - Intergenic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
945820331 2:214656769-214656791 GGGGTCTACCAGAAGGTGGAGGG - Intergenic
947476907 2:230458378-230458400 GAGTAGTTTGAGAAGGAGGAAGG + Intronic
948053004 2:234992414-234992436 GAGGAGTGTCACAAGGAGGAAGG + Intronic
948138962 2:235659069-235659091 GTGGACTTGCAAAAGGAGGCTGG - Intronic
948583839 2:239005977-239005999 AAGGGCTTCTAGAAGGAGGCGGG - Intergenic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1169701333 20:8450154-8450176 GAGCACTTCCAGGAGTAGGATGG - Intronic
1170131332 20:13023114-13023136 GAAGACTTCAAGTAGGAGAAGGG - Intronic
1170473155 20:16688344-16688366 GAGGACTTCCCCAAGGAGTGAGG + Intergenic
1170599810 20:17832700-17832722 GAGGTGTTCCAGAAGAAGGAAGG + Intergenic
1170706117 20:18746058-18746080 GGAGACATCCAGAAGGATGAGGG + Intronic
1170869529 20:20192431-20192453 GAGCCCTGACAGAAGGAGGAGGG + Intronic
1170902459 20:20478690-20478712 GGGAACTACCAGAAGGGGGAGGG + Intronic
1171098286 20:22354535-22354557 GTGGACTTCCAGATGGGGGCTGG + Intergenic
1171329505 20:24325266-24325288 GGAGACTTCAAGAAGGAGGAAGG + Intergenic
1171492673 20:25532298-25532320 TAGGATTTCCAGAAGAGGGAAGG + Intronic
1172031985 20:31988773-31988795 GAGGGCTTCCTGTAGGAAGAAGG + Intronic
1172299282 20:33837519-33837541 GAGGAATTTCAGAGAGAGGAGGG + Intronic
1173477015 20:43367021-43367043 GGGGACTACCAGAGGGAGGAAGG + Intergenic
1173795746 20:45858037-45858059 GAGGGCTGCCTGGAGGAGGAGGG + Intronic
1174725722 20:52859678-52859700 GAGGTCTTCCTGGAAGAGGAGGG - Intergenic
1174924117 20:54738312-54738334 GGGGTCTTCCAGAAGGTGGAGGG + Intergenic
1175137464 20:56835228-56835250 GAAGCCTTCCTGAAGGAGGCAGG + Intergenic
1175249593 20:57601205-57601227 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1175647619 20:60688151-60688173 GAAGCCTACAAGAAGGAGGAAGG + Intergenic
1175923958 20:62462984-62463006 GAAGGCTTCCAGGAGGAGGTGGG + Intergenic
1176051273 20:63120852-63120874 GAGGACTTTGGGGAGGAGGATGG - Intergenic
1176079970 20:63267604-63267626 CAGGACCTCCAGAGGGAGCACGG - Intronic
1176139267 20:63537971-63537993 GAGGACTTCCCGGAAGAGGAGGG + Intergenic
1176986588 21:15444660-15444682 GAGTCCTTCCAAGAGGAGGATGG - Intergenic
1177309024 21:19362893-19362915 GAGGCCTCCCAGAGGGTGGAGGG - Intergenic
1177509465 21:22065740-22065762 GGAGACTTCCTGAAAGAGGAAGG + Intergenic
1177586094 21:23097765-23097787 GGGAACTTGCACAAGGAGGAGGG - Intergenic
1177871463 21:26578183-26578205 GGGGACTTATAGAAGGCGGAAGG - Intergenic
1178323937 21:31628187-31628209 AAGGACTTTCAGAAAGAAGAGGG - Intergenic
1178765618 21:35448228-35448250 GATGACCTCCTGAAAGAGGAAGG - Intronic
1179154773 21:38840279-38840301 GGGGATTTCCAGAAGGAGACTGG + Intergenic
1180516705 22:16151160-16151182 AAGGACTTGCAGAACCAGGAAGG + Intergenic
1180600495 22:17012293-17012315 GAGGGCTTCTTGGAGGAGGAGGG + Intergenic
1181027624 22:20134899-20134921 GAAGGCTTCCTGAAGGAAGAGGG - Intronic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181902391 22:26167618-26167640 GAGGCCTACCAGAGGGTGGAAGG + Intergenic
1182026664 22:27124499-27124521 GAGGGCTCCCAGAAGGCGGCAGG + Intergenic
1182102350 22:27667167-27667189 GCTGGCTTCCAGAAGGAGCATGG - Intergenic
1182398672 22:30057023-30057045 GGGAAGTTCCAGAAGGAGAAGGG + Intergenic
1182679024 22:32063851-32063873 GAGGGAGTCCAGAATGAGGAAGG + Intronic
1182851428 22:33477962-33477984 GAGGGCTTCCAGGAAAAGGAAGG - Intronic
1183264493 22:36816956-36816978 GAGGACATCAAGAAGGCGGTGGG - Exonic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1184362628 22:44027334-44027356 GAGGACTTCCAGCAGCAGCTGGG - Intronic
1184684800 22:46091415-46091437 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684836 22:46091559-46091581 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684845 22:46091595-46091617 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
949495713 3:4629806-4629828 GAGGGCTTCCTGGAGGAAGAAGG + Intronic
949610140 3:5695896-5695918 AAGGACTTACAGAACCAGGAAGG - Intergenic
949720363 3:6982284-6982306 GAGGACTACAAGAGGGAGAAGGG + Intronic
951330612 3:21363971-21363993 GAGGAATACAAGAAGAAGGAAGG + Intergenic
951376421 3:21923823-21923845 GGGGACTACTAGAAGGGGGAGGG + Intronic
951758961 3:26124185-26124207 GTGGACTACTAGAAGGGGGAGGG + Intergenic
951840935 3:27033388-27033410 GATTACTTCAAGAAAGAGGATGG - Intergenic
952030449 3:29135840-29135862 GAGGACTACTAGAGGGAGGAGGG + Intergenic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
953230356 3:41059098-41059120 GGGGACTACTAGAGGGAGGAGGG - Intergenic
953469651 3:43155813-43155835 AAGGATTTCCAGAAGAAGAAGGG - Intergenic
953569163 3:44057736-44057758 GATGACCTCGAGAGGGAGGAAGG - Intergenic
953637721 3:44676865-44676887 GAGGACTAATAGACGGAGGAGGG + Intergenic
953718799 3:45337483-45337505 GAGATCTTCCAGAAGGCAGAGGG + Intergenic
954156419 3:48687336-48687358 GAGGGCTTCTGGGAGGAGGAAGG - Intergenic
954224434 3:49173061-49173083 GAGGCCTTCCTGATGGATGAGGG + Exonic
954486143 3:50853465-50853487 GGGGACTCCAAGAAGCAGGAAGG - Intronic
954711328 3:52506436-52506458 GAGGACTCCAAAAAGGAGCATGG + Intronic
955442687 3:58974261-58974283 GAGGACTACTAGTAGGGGGAAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956324854 3:68040690-68040712 TAGGTCTGGCAGAAGGAGGAAGG - Intronic
959371245 3:105528718-105528740 GGGGCCTTTCAGAGGGAGGAGGG + Intronic
959912494 3:111779401-111779423 GGGGACTACTAGAGGGAGGAGGG - Intronic
960367223 3:116787254-116787276 GAGGACTACAAGAAGGGGGAGGG - Intronic
961093972 3:124139037-124139059 GAGGACTTGCAGCAGGAGGCTGG + Intronic
961790420 3:129371961-129371983 GAGGACTACTAGAGGGAGGAGGG - Intergenic
963035324 3:141020651-141020673 GATGGCTTCCAAGAGGAGGAAGG + Intergenic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
965063712 3:163816050-163816072 GAGGACTACTAAAAGGAAGAGGG + Intergenic
966475096 3:180335690-180335712 GGGGCCTTTCAGAGGGAGGAGGG - Intergenic
966563460 3:181349322-181349344 GGGGCCTTTCAGAGGGAGGAGGG + Intergenic
966668695 3:182502178-182502200 AGGGACTTGGAGAAGGAGGAAGG + Intergenic
967337898 3:188364613-188364635 GAAGACTTTCTGGAGGAGGAGGG + Intronic
967393547 3:188981215-188981237 CAGGACTTCAACAAGGGGGAGGG + Intronic
967470905 3:189861002-189861024 GAGGACTCCAAAAATGAGGAAGG - Intronic
967533710 3:190578046-190578068 GAGAACTACCAGAGGGAGGTGGG + Intronic
967548225 3:190758133-190758155 GAGGCCTTTCAGAGGGTGGAGGG + Intergenic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
967925692 3:194644707-194644729 GATCTCTTCCAGGAGGAGGATGG + Exonic
969620505 4:8276536-8276558 GAGGGCTTCCTGTAAGAGGAGGG + Intronic
972286852 4:37657518-37657540 GATGACTTCCATATGAAGGAGGG + Intronic
972769484 4:42184004-42184026 GTGGACTCCTAAAAGGAGGATGG + Intergenic
973126274 4:46589404-46589426 GGGGACTATCAGAAGGTGGAGGG - Intergenic
973221933 4:47736636-47736658 GGGGTCTACCAGAAGGTGGAGGG - Intronic
973529337 4:51819234-51819256 GGGGACAGCCAGAAGAAGGATGG + Intergenic
974120068 4:57627442-57627464 GGGGACTACTAGAAGGTGGAGGG + Intergenic
975699745 4:77052120-77052142 GGGGACTACTAGAAGGGGGAGGG - Intronic
975927599 4:79477239-79477261 GTGGTCTTCCTGAAGGTGGAGGG - Intergenic
975936156 4:79583490-79583512 GGAGACTTCCAGAGGGAAGAGGG + Intergenic
976197584 4:82548171-82548193 GAGGACTACCAGAGAGGGGAGGG + Intronic
976874520 4:89837160-89837182 GAGGACTAGGAGGAGGAGGACGG - Intronic
977322826 4:95540535-95540557 GAGGAGATCCAGAAGGAAAAAGG + Intronic
977517314 4:98036643-98036665 GAGGTCTTTCAGAGGGTGGAGGG + Intronic
977671320 4:99698894-99698916 GAGGACGACCAGAAGCAGGGTGG + Intergenic
977927301 4:102715648-102715670 GGGGCCTGCCAGAAGGTGGAGGG - Intronic
978949461 4:114540201-114540223 GGGGACTACTAGAAGGAGGAGGG - Intergenic
979026588 4:115585084-115585106 GAGGACTACTAGAAGAAAGAGGG - Intergenic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
980236974 4:130120884-130120906 GGGGACTTCAAGAGGGAGGTGGG + Intergenic
982419592 4:155178861-155178883 TGGGAGTTCCAAAAGGAGGAAGG - Intergenic
982618625 4:157675560-157675582 GAGGACTTTCAGAAAGAAGGTGG + Intergenic
984237067 4:177172432-177172454 TGGGACTTCTAGAGGGAGGAGGG - Intergenic
984962159 4:185108381-185108403 CCGGAATTCCAAAAGGAGGAGGG + Intergenic
985126697 4:186701704-186701726 GAGGACGTGCAGCAGGAGCAGGG + Intronic
985497861 5:219674-219696 GAGGGCGTCCACAAGCAGGAAGG + Intronic
986054323 5:4120881-4120903 GAGGTCTACCAGAGGGTGGATGG + Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986427071 5:7644267-7644289 GAGGAAATCAAGGAGGAGGATGG - Intronic
986667883 5:10118910-10118932 GAGGACTTCAAGAAGGAAGTTGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987691063 5:21267733-21267755 GAGGTTTTTAAGAAGGAGGAGGG + Intergenic
987760211 5:22152076-22152098 GAGGAATTCCAGAACGAGATGGG - Intronic
987931063 5:24399719-24399741 GAGTACTTACAGAATCAGGAAGG + Intergenic
988211800 5:28213820-28213842 GAGGACTTCCAAATCAAGGATGG + Intergenic
988308775 5:29529703-29529725 GAGGAATTACATAAGGAGAAAGG + Intergenic
988320761 5:29693264-29693286 GTGGACTTCTAGAGGGAGGAGGG - Intergenic
988442560 5:31249508-31249530 GTGGCCATCCAGAATGAGGAAGG + Intronic
988483308 5:31647464-31647486 TAGAGCTTCCAGAAGGAGCACGG - Intronic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
988702043 5:33685239-33685261 GAAAACTTCCAGCAGGAGGAAGG + Intronic
988780209 5:34513797-34513819 GAGCTCTTCTAGAAGGAGGAAGG + Intergenic
990222086 5:53603458-53603480 GAGGACTTCCACATGGAGATTGG + Exonic
991015250 5:61925414-61925436 GAGGACCTCCAGAGGCAAGAAGG - Intergenic
991119099 5:62990372-62990394 GTGGACTACTAGAAGGGGGAGGG + Intergenic
991894952 5:71385513-71385535 GAGGAATTCCAGAACGAGGTGGG - Intergenic
992102056 5:73417589-73417611 GAGGAATTCCTGGAGGAGGGAGG + Intergenic
992161333 5:74006542-74006564 GAGGACTACTGGAGGGAGGAGGG - Intergenic
994256759 5:97606111-97606133 GGGGACTACAAGAAGGAAGAGGG + Intergenic
994559820 5:101353530-101353552 GAGGACTCCAAAAAGGGGGAAGG + Intergenic
995700781 5:114932758-114932780 GTGGACTTCTAGATGGGGGAGGG - Intergenic
996165768 5:120220890-120220912 GGGGACTTCAAAAATGAGGATGG - Intergenic
996288381 5:121822824-121822846 GTGGACTACCAGAGGGTGGAGGG - Intergenic
996576644 5:124983268-124983290 GAGGACTACTAGAAGGAGAAGGG - Intergenic
996804600 5:127440725-127440747 GAGGACATCCTGTGGGAGGAGGG - Exonic
997329534 5:133049696-133049718 GAGGTCTTCCAATAGAAGGAAGG + Intergenic
997436629 5:133880387-133880409 GAGGGCTTCCTGGAGGAGGCAGG - Intergenic
997864209 5:137446520-137446542 GAGGAATTCCCATAGGAGGAAGG + Intronic
999247369 5:150162292-150162314 GAGGGCTTCCAGGGGGAAGAGGG + Intergenic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
1001034917 5:168291087-168291109 GAGGACTTCCAGAGGGTGTCAGG - Intergenic
1001387295 5:171350256-171350278 GAGGACTACTAGATGGGGGAGGG - Intergenic
1001459660 5:171899916-171899938 AAGGACTTTCAGAAAGAAGAGGG - Exonic
1002107427 5:176887072-176887094 GTGGACTTCCAGCAGAAGCAGGG - Exonic
1002342456 5:178526094-178526116 GAGGGCTTCCTGAAGGAGAGAGG + Intronic
1002652065 5:180705785-180705807 GAGGACTACTAGAAGGGGGGAGG - Intergenic
1002887397 6:1309922-1309944 GTGGACTTTGAGAAGGAAGATGG - Intergenic
1003097404 6:3153879-3153901 GGGGAGTTCGAGGAGGAGGAGGG - Exonic
1003106944 6:3224767-3224789 GGGGAGTTCGAGGAGGAGGAGGG - Exonic
1006025363 6:31143317-31143339 GAGGAGGCCCGGAAGGAGGAGGG - Exonic
1006370173 6:33639426-33639448 GAGGAGGTACAGAAGGAGCACGG + Intronic
1006431950 6:34002539-34002561 GAAGGCTTCCTGAAGGAGGTAGG + Intergenic
1007073451 6:39052450-39052472 AAGGCCTCTCAGAAGGAGGAAGG - Intronic
1007622069 6:43221369-43221391 GAGGCCTGGCAGAAGGAGGGGGG + Intronic
1007755716 6:44097974-44097996 GATGACTTCCTGGGGGAGGAGGG - Intergenic
1007836883 6:44680903-44680925 GAAGGCTTCCTGAAGGAGGTGGG - Intergenic
1009198486 6:60715761-60715783 TGGGACTACTAGAAGGAGGAGGG + Intergenic
1009803073 6:68567344-68567366 GAGGACTCCAAAAGGGAGGAGGG - Intergenic
1012469355 6:99553594-99553616 GAAGATTTACTGAAGGAGGAAGG - Intronic
1012490150 6:99774070-99774092 GGGGCCTACCAGAAGGTGGATGG - Intergenic
1012909849 6:105106284-105106306 AAGGACTTCCATAAGGACCAAGG + Intronic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013419603 6:109954820-109954842 GAAGACTACCAGAAGGAGAGGGG + Intergenic
1013479278 6:110539285-110539307 GTGGACTACTAGAGGGAGGAGGG - Intergenic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1014274170 6:119368101-119368123 CAGGACTACTAGAAGCAGGAGGG + Intergenic
1014500988 6:122189159-122189181 GGGGTCTTTCAGAAGGTGGAGGG - Intergenic
1014877973 6:126684726-126684748 GTGGACTACTAGAAGGGGGAGGG + Intergenic
1015268944 6:131319395-131319417 GAGGACTACTAGAAGGGAGAAGG + Intergenic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015613044 6:135046206-135046228 GAAGGCTTCTAGAAGGAGGTGGG - Intronic
1015691031 6:135923029-135923051 GAGGTTTTCCAGAAGGTGGTTGG - Intronic
1015706887 6:136097845-136097867 GAGGACTTGTGGCAGGAGGATGG - Intronic
1015976545 6:138796534-138796556 GAGAACTGTCAGAAGGAAGAAGG - Intronic
1016353802 6:143195725-143195747 GAGCACTTCCAGAAGGAGGCAGG + Intronic
1016898186 6:149074576-149074598 TAGGACATCGAAAAGGAGGATGG + Exonic
1017506437 6:155072805-155072827 GAGGAGTTCAGGAAGGAGGCTGG + Intronic
1017894003 6:158663562-158663584 GAGGACGCTCAGGAGGAGGAGGG + Intronic
1018322905 6:162632486-162632508 GGGGACTATGAGAAGGAGGAGGG + Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019777251 7:2919192-2919214 AAGGGCTTCCTGGAGGAGGAGGG + Intronic
1020320330 7:6934988-6935010 GGGGACTTGCGGCAGGAGGAGGG - Intergenic
1020478723 7:8630928-8630950 GAGGCCTTTCAGAGGGTGGAGGG - Intronic
1021952815 7:25791629-25791651 GGGAACTACAAGAAGGAGGAGGG - Intergenic
1022961904 7:35435218-35435240 GGGGACTACAAGAAGGGGGAGGG + Intergenic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1023843041 7:44107408-44107430 CAGGAGTTCCAGAAGCAGGTGGG - Intronic
1024058702 7:45682650-45682672 TAGGACGGCGAGAAGGAGGATGG - Intronic
1024355353 7:48408847-48408869 GAGGTCTACCAGATGGTGGAGGG - Intronic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1026842977 7:73681103-73681125 GAGGTCTACGAGAAGGATGAGGG - Exonic
1026963720 7:74426045-74426067 GATGACTTCCTGGAGGAGGCAGG + Intergenic
1026974913 7:74491480-74491502 GGGGCCTTTCAGAAGGTGGAGGG - Intronic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1027430096 7:78103025-78103047 GAGGAATTCCAGATAGAAGAAGG - Intronic
1027923707 7:84432540-84432562 GGAGACTACCAGAAAGAGGAGGG - Intronic
1028325413 7:89518258-89518280 GTGCCCTCCCAGAAGGAGGAAGG - Intergenic
1028921327 7:96313600-96313622 GGGGACTACTAGAGGGAGGAGGG + Intronic
1028922886 7:96326405-96326427 GAGGAATTCTAGAATGAGGAGGG - Intergenic
1029179279 7:98688266-98688288 GGGGGCTTCCAGGAGGAGGTGGG + Intergenic
1029623825 7:101707268-101707290 GAAGGCTTCCTGAAGGAGGTGGG - Intergenic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1030632074 7:111907032-111907054 GAGACCTTCAAGGAGGAGGAAGG + Intronic
1030883663 7:114913164-114913186 TAGGGCCTCCAGATGGAGGATGG - Intergenic
1031036776 7:116796098-116796120 GATGTCTCCCAGAAGGAGGCTGG - Exonic
1032453465 7:132054169-132054191 GAGGAATTCCAGTGAGAGGAGGG + Intergenic
1032912647 7:136451313-136451335 GGGGCCTTTCAGAGGGAGGAGGG - Intergenic
1033217172 7:139501496-139501518 GGGGACTTCTAGATGGGGGAGGG + Intergenic
1033284790 7:140031818-140031840 AATGACTTCCAGAAATAGGAGGG + Intronic
1033560837 7:142528901-142528923 GAAGACTTCCCGAAGGCGGAGGG + Intergenic
1033597474 7:142867674-142867696 GATGGCTGCCAGCAGGAGGAAGG - Exonic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1034659801 7:152759513-152759535 GAAGACTTACAGGAGGAGAAAGG + Intergenic
1035291680 7:157843462-157843484 GAGGAGCTCCAGGTGGAGGAAGG - Intronic
1035688991 8:1547523-1547545 GGGGCCTGCCAGAAGGAGGAAGG + Intronic
1036381178 8:8237442-8237464 GGGGGCTTGCAGCAGGAGGAGGG + Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037079680 8:14768729-14768751 GAACACTTACAGATGGAGGAAGG + Intronic
1038730857 8:30126449-30126471 GAGGACTTGGAAAAGGAGGTTGG - Intronic
1039212341 8:35232095-35232117 GAGGACTTACAGATTGAGCATGG - Intergenic
1039737420 8:40347711-40347733 CAGGAGGTCAAGAAGGAGGAAGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040857914 8:51969547-51969569 GAGGACTCCAATGAGGAGGAAGG - Intergenic
1041728405 8:61039996-61040018 GAGGACTACTAGAAGGAGTGAGG - Intergenic
1041731494 8:61067811-61067833 GGGGACTACTAGAAGGGGGAGGG + Intronic
1042001251 8:64125406-64125428 GAGGTCTTCTTGAAGAAGGATGG + Intergenic
1042302160 8:67296166-67296188 AAGTACTTCCACAAGGAAGATGG + Intronic
1042360433 8:67876859-67876881 GGGGAATACAAGAAGGAGGAAGG + Intergenic
1043214168 8:77564571-77564593 GAGGCCTTCCAGAAGGTGGAAGG + Intergenic
1043258906 8:78172776-78172798 GAGGCCTTTCAGAGGGTGGAGGG + Intergenic
1044009122 8:86970259-86970281 GTGAAATTCCAGAAGGAGTAGGG - Intronic
1044804512 8:95991477-95991499 GAGGCCTTTCAGAGGGTGGAGGG + Intergenic
1044936953 8:97302617-97302639 GGGGAGTTCCAGATGGAGGTGGG - Intergenic
1045268750 8:100643954-100643976 GAGGACTTCCTGGAGGAGATGGG + Intronic
1045964333 8:108006619-108006641 GAGGAATTCAAGAAGAAAGAAGG + Intronic
1045976692 8:108137725-108137747 GAGGGCCTCAAGAAGCAGGAAGG + Intergenic
1047359621 8:124156172-124156194 GGGGACTACTAGAGGGAGGAGGG - Intergenic
1047451310 8:124967363-124967385 CAGAACTTCCAGCTGGAGGATGG - Intergenic
1047836686 8:128701428-128701450 GAAGACTTCCAGAATGGGTATGG - Intergenic
1048919521 8:139215306-139215328 GAGGACCTTAGGAAGGAGGAGGG - Intergenic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049268973 8:141684144-141684166 GAGGGCTTCCCCAAGGAGGGTGG - Intergenic
1049269499 8:141686746-141686768 GAGGACCCCCGGAAGGAGAAGGG - Intergenic
1049309512 8:141925889-141925911 TAGGACTTCCAGGAGGAGGGAGG + Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1049405616 8:142450683-142450705 GAGGGCTTCGAGAAGGAGTCTGG - Intronic
1049885480 9:23537-23559 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
1050267574 9:3906940-3906962 GAGGAGTTACATTAGGAGGAGGG - Intronic
1050849487 9:10265230-10265252 TAGGACTTCCAAAAGCAGCAAGG - Intronic
1051288586 9:15522281-15522303 GTGAACTTCTAGGAGGAGGAAGG - Intergenic
1052736140 9:32344569-32344591 GAAGGCTTCCAGAAGGCAGAAGG - Intergenic
1052758972 9:32570158-32570180 GAGGACATCTGGAAGAAGGATGG - Intronic
1052772634 9:32703657-32703679 GAGTACTTAAAGGAGGAGGAGGG - Intergenic
1052856051 9:33407250-33407272 GAAGGCTTCCTGAAGGAAGAGGG + Intergenic
1052986532 9:34491961-34491983 GAGGACTTGAAGGGGGAGGAGGG - Intronic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1053298854 9:36934660-36934682 GAGGGCTTCCTGGAAGAGGAAGG - Intronic
1053344083 9:37365134-37365156 GAAGACTACCAGAAGAAGGGCGG - Intergenic
1053922253 9:43007283-43007305 GGGGCCTTCTAGAAGGTGGAAGG + Intergenic
1054766826 9:69049027-69049049 CAGAACTGCCAGAAGGAGTAAGG - Intronic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1056847719 9:90055261-90055283 GATGCTTTCCAGAAGGAGGGTGG + Intergenic
1057809940 9:98250111-98250133 GAAGGCTTCCAGGAGGAGGCTGG + Intronic
1057891591 9:98874110-98874132 GATGGCACCCAGAAGGAGGAAGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1059014354 9:110498343-110498365 AAGGAGTTCCAGAAGGAGAGAGG - Intronic
1059365192 9:113781388-113781410 GAAGGCTTCCTGAAGGAGGAGGG - Intergenic
1059525747 9:114989542-114989564 GAGGACCCCAAGAAGGAGCAGGG - Intergenic
1059708290 9:116843731-116843753 GGGGACTACCAGATGGGGGAAGG + Intronic
1059972512 9:119682178-119682200 GAGGCCTTTCAGAGGGTGGAGGG - Intergenic
1060052086 9:120384796-120384818 GAGTTCCTCCAGAAGGAGGCTGG + Intergenic
1060080620 9:120640860-120640882 GGGGACTACTAGAAGGGGGAGGG - Intronic
1060231179 9:121826811-121826833 GGGGCCTTGCAGAATGAGGAGGG + Intronic
1060736130 9:126067526-126067548 GAGGCCTTCCTGGAGGAGGAGGG - Intergenic
1060773454 9:126349373-126349395 GAGGTCTTGCAGAAGCAGGGAGG - Intronic
1061865786 9:133491152-133491174 GAGGACTTGGAGGAGGAGGGAGG + Intergenic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1062277616 9:135738164-135738186 GAGGGCTTCCTGGAGGAGGTGGG - Intronic
1062421883 9:136486597-136486619 GAGCTCTTCCTGGAGGAGGAGGG + Intergenic
1062473021 9:136714496-136714518 GAGGACAGCCAGGAGGAGGGAGG - Intronic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1186118647 X:6333454-6333476 GGGGCCTTTCAGAAGGTGGAGGG - Intergenic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1187142865 X:16611025-16611047 GGGAACTACCAGAGGGAGGAAGG + Intronic
1187224167 X:17359931-17359953 TATGACTTCCAGGAGGAGGATGG + Intergenic
1187568100 X:20473237-20473259 GAAGACTTCATGAAGGAGGTAGG + Intergenic
1188043567 X:25399282-25399304 GAGGACTACTAGAAGGCAGAGGG + Intergenic
1188580587 X:31707457-31707479 GGGGACTACTAGAGGGAGGAGGG + Intronic
1188631836 X:32373004-32373026 GAGAACTTCCAGAAGTAGTGAGG - Intronic
1188790368 X:34402162-34402184 GTGGACTACTAGAAGCAGGAGGG + Intergenic
1189422735 X:40870984-40871006 GGGGACTACTAGAAGGGGGAGGG - Intergenic
1189424624 X:40886986-40887008 GAGGACTACTAGAGGGAGGAGGG - Intergenic
1189971102 X:46419092-46419114 GAGCACTTCCTGAAGGGCGAGGG - Intergenic
1190284042 X:48950428-48950450 GAGAGCTTCCAGAAGGAGTGTGG + Intronic
1190870077 X:54417491-54417513 GGGGACTACCAGAATGGGGAGGG + Intergenic
1191971307 X:66819751-66819773 GGGGGGTTCCAGAGGGAGGAGGG + Intergenic
1191989942 X:67024319-67024341 GGGGACTTTCAGAGGGTGGAAGG - Intergenic
1192022768 X:67411727-67411749 GAGGCCTTTCAGAGGGTGGAAGG - Intergenic
1192564541 X:72152775-72152797 TAGGATTTCCAGAATTAGGAAGG + Intergenic
1192838224 X:74825387-74825409 GAGGACTTCCAGATGGTGGGGGG - Intronic
1192886608 X:75341927-75341949 GGGGCCTTTCAGAAGGTGGAGGG - Intergenic
1192991332 X:76460777-76460799 GGGGACTACTAGAAGAAGGAGGG + Intergenic
1193070716 X:77303113-77303135 GGGGACTACTAGATGGAGGAGGG + Intergenic
1193495962 X:82213287-82213309 GGGGCCTACCAGAGGGAGGAGGG - Intergenic
1194112123 X:89847537-89847559 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1194320439 X:92440311-92440333 GAGGACTACCAGAGTGGGGAGGG - Intronic
1194541816 X:95182456-95182478 GAGGACATTCAGAAGTAGAATGG + Intergenic
1195656873 X:107340251-107340273 AAAGACTTCCAGAAGGAGGTGGG + Intergenic
1195728615 X:107942385-107942407 GGGGACTACCTGAAGGAGAAGGG + Intergenic
1195847247 X:109241644-109241666 GAGGACCTTCAGAGGGAGAAAGG - Intergenic
1196207960 X:112962609-112962631 GAAGACTTCCAAAGGTAGGAGGG + Intergenic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1197576450 X:128218075-128218097 GTGGACTACTAGAGGGAGGATGG + Intergenic
1197666778 X:129232744-129232766 GAGGACTTCCAGAGGCCAGAGGG + Intergenic
1197923847 X:131626064-131626086 GAGAATTTAAAGAAGGAGGAGGG + Intergenic
1197949028 X:131874219-131874241 GAGTAGTTCCAGAAGGTGTAAGG - Intergenic
1198376231 X:136042593-136042615 GAGGACTGCAGGTAGGAGGAAGG - Intronic
1198787962 X:140312061-140312083 GGGGACTACTAGAAGGGGGAGGG + Intergenic
1199236016 X:145493519-145493541 GAGGACTACCCGAAGCCGGAGGG + Intergenic
1199271155 X:145883785-145883807 CAGGAGTTCTAGAAGTAGGAAGG + Intergenic
1199714049 X:150493278-150493300 GAGCACGTCCAGAAGGAGCGTGG + Intronic
1199866893 X:151859783-151859805 GGGGACTTTCAGAGGGTGGAGGG + Intergenic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic
1200464778 Y:3502317-3502339 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1200628553 Y:5553441-5553463 GAGGACTACCAGAGTGGGGAGGG - Intronic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic
1201484167 Y:14474612-14474634 GGGGACTACTAGAGGGAGGAAGG - Intergenic
1201794741 Y:17882837-17882859 GTGGTCTTCAAGGAGGAGGAAGG - Intergenic
1201806814 Y:18023148-18023170 GTGGTCTTCAAGGAGGAGGAAGG + Intergenic
1202356116 Y:24050616-24050638 GTGGTCTTCAAGGAGGAGGAAGG - Intergenic
1202514662 Y:25619493-25619515 GTGGTCTTCAAGGAGGAGGAAGG + Intergenic