ID: 1075600520

View in Genome Browser
Species Human (GRCh38)
Location 10:123764772-123764794
Sequence ACAGAAGAAACCCAAAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 967
Summary {0: 1, 1: 0, 2: 11, 3: 96, 4: 859}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075600520 Original CRISPR ACAGAAGAAACCCAAAGAAA GGG (reversed) Intronic
900000756 1:13655-13677 ACAGGGGAATCCCGAAGAAATGG + Intergenic
900272644 1:1799883-1799905 AAAGAAGAAAGCCACAGAAAGGG + Intronic
900718391 1:4159609-4159631 AAAGAAAATACCCAAGGAAAAGG + Intergenic
900821407 1:4892181-4892203 ACATGACAAACCCAAAGACAAGG - Intergenic
901374570 1:8828578-8828600 ACAGAGAAAACCCAAAAGAAGGG + Intergenic
901893095 1:12284934-12284956 ACACATGAAGCCCAAAGGAATGG - Intronic
901959374 1:12812456-12812478 ACAGAAGAGACCCAAAGCCCTGG + Intergenic
901961366 1:12828811-12828833 AGAGGACAAACCCAGAGAAAAGG + Intronic
901967953 1:12883416-12883438 AGAGGACAAACCCAGAGAAAAGG + Intronic
901974635 1:12934580-12934602 ACAGAAGAGACCCAAAGCCCTGG + Intronic
901975760 1:12942546-12942568 AGAGGACAAACCCAGAGAAAAGG + Intronic
901983355 1:13053681-13053703 AGAGGACAAACCCAGAGAAAAGG + Intronic
901985655 1:13073650-13073672 AGAGGACAAACCCAGAGAAAAGG - Intronic
901986959 1:13083302-13083324 ACAGAAGAGACCCAAAGCCCTGG - Intergenic
901994853 1:13143465-13143487 ACAGAAGAGACCCAAAGCCCTGG + Intergenic
901996154 1:13153117-13153139 AGAGGACAAACCCAGAGAAAAGG + Intergenic
901998732 1:13175237-13175259 AGAGGACAAACCCAGAGAAAAGG - Intergenic
902005466 1:13228549-13228571 ACAGAAGAAACCCCAAGCTGTGG - Intergenic
902009414 1:13259219-13259241 AGAGGACAAACCCAGAGAAAAGG - Intronic
902010538 1:13267187-13267209 ACAGAAGAGACCCAAAGCCCTGG - Intergenic
902407578 1:16193841-16193863 ACAGAAGAATTCCAAATAATTGG + Intergenic
902463446 1:16598152-16598174 TGAGAAGAAACCAAAAGCAACGG - Intronic
902526962 1:17065442-17065464 ACAAAACAAAACCAAAAAAAGGG + Intergenic
903158073 1:21462549-21462571 TGAGAAGAAACCAAAAGCAATGG + Intronic
903435564 1:23346142-23346164 AGAGAAGAAAAGGAAAGAAAAGG + Intergenic
903587807 1:24429641-24429663 GCAGAAGCAAAGCAAAGAAATGG + Intronic
903841235 1:26242543-26242565 TCAGTAGAAAGCCAAAGTAAGGG + Intronic
904041066 1:27585604-27585626 ACTGAAGACACACAAGGAAACGG + Intronic
904316266 1:29666997-29667019 CCAAAAGAAACCAGAAGAAAAGG + Intergenic
904597052 1:31653528-31653550 ATAGAAGAAACAGAAAGAAAAGG + Intronic
904659817 1:32076084-32076106 AAAGAAGAAAAGAAAAGAAAAGG - Intronic
904707148 1:32400067-32400089 ACCAAAGAAACCCAAGCAAAGGG - Intergenic
904874773 1:33645932-33645954 ACAGACAAAACAGAAAGAAATGG - Intronic
905164557 1:36071219-36071241 ACAAAAAAAACCCTAAGTAATGG + Exonic
905691463 1:39946267-39946289 TCAGTAGAAACCCAAACACAAGG + Intergenic
906893880 1:49749394-49749416 ATAGAAGAAAAACAAATAAAAGG + Intronic
907587582 1:55634836-55634858 AAAGAATAAAGCCAAAGGAAAGG - Intergenic
907686552 1:56617308-56617330 ACAGAAGCAACAGAAAGAAAAGG + Intronic
907691442 1:56671067-56671089 ACAAAAGAAATTAAAAGAAAAGG - Intronic
907691998 1:56678329-56678351 ACAAAAGAAAACCACTGAAAGGG - Intronic
907723407 1:56995638-56995660 TCAGAAGCAACCCAAAGAATTGG + Exonic
907779023 1:57547580-57547602 TCAGAAGAACCCCAGAGACAGGG + Intronic
908440197 1:64146004-64146026 ACAGAGGAAACCAAATGAACTGG + Intronic
908698089 1:66867459-66867481 AGAGAAGAAAAACAAAGAGATGG - Intronic
909258605 1:73457407-73457429 ACTGCAGGAAACCAAAGAAAGGG + Intergenic
909267855 1:73584647-73584669 AGAGAAGAAACAAAAAGACAAGG + Intergenic
910393685 1:86770384-86770406 ACAAAAGAAATCCAAAAGAAAGG - Intergenic
910448644 1:87325252-87325274 ACAGAAAAAACCCAAGGAAGAGG - Intergenic
910584167 1:88861243-88861265 ACATAAGATACCTAAGGAAATGG + Intronic
910843053 1:91579136-91579158 ACAGTGAAAACCCAGAGAAATGG + Intergenic
910910129 1:92224733-92224755 ACAAATTAAACCCAAAGCAATGG - Intronic
911130285 1:94380840-94380862 ACACAGGAAACCAAAAGACAAGG - Intergenic
911198761 1:95022622-95022644 ACTGAGGAAACCTAAACAAATGG + Intronic
911460545 1:98183628-98183650 ACAGAACAATCGCACAGAAAGGG - Intergenic
911536728 1:99108792-99108814 ACAGGAGAAAGGGAAAGAAAAGG + Intergenic
911636305 1:100239561-100239583 AAAAAAGAAAGCAAAAGAAAAGG + Intronic
912602751 1:110954537-110954559 AGAGAATAAACCCAAAGAAAAGG + Intronic
912973184 1:114303419-114303441 AAAGTAGAAAACCCAAGAAATGG - Intergenic
913530395 1:119729874-119729896 ACAGAAGAAATGCAAAGTGAAGG - Intronic
913544152 1:119850682-119850704 TGAGAAGAAACCAAAAGCAATGG - Intergenic
913991546 1:143617601-143617623 TGAGAAGAAATCAAAAGAAATGG - Intergenic
914736972 1:150427170-150427192 AAAAAAGAAAAACAAAGAAAAGG + Intronic
914860248 1:151379880-151379902 AAAAAAAAAACCTAAAGAAAAGG + Intergenic
915919121 1:159960980-159961002 AGGGAGGAAAGCCAAAGAAAAGG - Intergenic
916676816 1:167070912-167070934 AGAGAGGAAACACAAAGGAAGGG + Intronic
916788735 1:168105865-168105887 ACAGAAGACACCAAAAAGAAAGG + Intronic
916948615 1:169756831-169756853 AAAGGAGAAATCCAGAGAAAGGG - Intronic
917350958 1:174077054-174077076 ATGGAAGAAACCAAAAGAAATGG - Intergenic
917503515 1:175607123-175607145 AAAGAAGAAATAGAAAGAAATGG - Intronic
917554089 1:176066224-176066246 AAGGGAGAACCCCAAAGAAATGG - Intronic
917646190 1:177030985-177031007 AGAGAAAAGACCAAAAGAAAGGG + Intronic
917746766 1:178017220-178017242 CCAGAATACAGCCAAAGAAATGG + Intergenic
918601465 1:186367834-186367856 ACAGAAGAAAAATAAAGGAATGG + Intronic
919197001 1:194298833-194298855 AAAGAATAATCCCAAACAAAGGG + Intergenic
919197919 1:194312648-194312670 ACAAAACAAAACAAAAGAAATGG + Intergenic
919409982 1:197230766-197230788 ACATAATTTACCCAAAGAAAAGG + Intergenic
919578697 1:199343594-199343616 ACAGAAGAAGAGAAAAGAAATGG - Intergenic
919977484 1:202622313-202622335 ACACAAGGAACTCAAAGAAATGG - Intronic
920052036 1:203170197-203170219 CCAGGAGAAACCCAGAGAGAGGG + Intronic
920244888 1:204579997-204580019 CCAGAAGAAATCAACAGAAAGGG - Intergenic
920341958 1:205280787-205280809 AAAAAAGAAAACCAAAGAAATGG + Intergenic
920384524 1:205560347-205560369 ACATAAGAAACTCAAACAACTGG + Intergenic
920583390 1:207134748-207134770 ACTGAAGAGGCCAAAAGAAAGGG - Intronic
921279145 1:213548668-213548690 AAAAAAGAAAAGCAAAGAAATGG + Intergenic
921444447 1:215228442-215228464 ACAGAAGAAAAAGAAGGAAATGG - Intronic
921655497 1:217731113-217731135 AGAGAAGAAACCATTAGAAATGG - Intronic
921787734 1:219251925-219251947 TCAGAAAAGACACAAAGAAATGG - Intergenic
921807110 1:219467822-219467844 TGAGAAAAATCCCAAAGAAATGG - Intergenic
921867432 1:220100731-220100753 GCAAACGAAACCCAAACAAAAGG - Intronic
921870735 1:220136654-220136676 AGAGAAGAAAAGAAAAGAAAAGG + Intronic
921959762 1:221022347-221022369 ACAGCAACAACCCAAAGAAAAGG - Intergenic
922549233 1:226481910-226481932 ACAGCATAAACCCAAAGACTAGG - Intergenic
922867490 1:228872567-228872589 AAAGAAGAAAAGAAAAGAAACGG - Intergenic
923232766 1:232004187-232004209 AGATAATAAATCCAAAGAAATGG + Intronic
924492920 1:244557379-244557401 ACTGAAGAAACACATATAAATGG - Intronic
924578841 1:245305299-245305321 ACAAAAGCAACCCACAGAATGGG + Intronic
924589867 1:245393637-245393659 AAAGAAAAGACCTAAAGAAACGG - Intronic
924808011 1:247377036-247377058 CCATAAGAAACCTAAAGAAAAGG + Intergenic
924824798 1:247528043-247528065 ACCGAAGAAACAGAAACAAATGG - Intronic
924841536 1:247714750-247714772 GAATAAGAAACACAAAGAAAGGG + Intergenic
1063216941 10:3933210-3933232 AATGAAGAAACCTTAAGAAAAGG + Intergenic
1063824846 10:9884062-9884084 ACAGAATAAATTCAAAGAAGTGG - Intergenic
1063907385 10:10795115-10795137 ACCGAAGAAACCAAAGGAAGGGG + Intergenic
1064364578 10:14695962-14695984 ACAGAAGAAGAAGAAAGAAAAGG - Intronic
1064371075 10:14751986-14752008 ACACCAGAAACCCAGAGCAAGGG - Intronic
1064388717 10:14922470-14922492 ATAAATGAAACCCAAAGAAGAGG + Intronic
1064455826 10:15486778-15486800 CCAGAAGAAACCAAAAGAGTTGG - Intergenic
1064649207 10:17491188-17491210 AAAGAAGAAACTCAAAGCAAGGG + Intergenic
1064679164 10:17792048-17792070 AAAAAAGAATCACAAAGAAAAGG - Intronic
1065314224 10:24446556-24446578 ACAAAAGAATCCCACAGAAATGG + Intronic
1065498017 10:26349893-26349915 ACAGAAAAATCTCAAGGAAAGGG + Intergenic
1065522093 10:26582834-26582856 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065522314 10:26584709-26584731 CCAGAAGATGCCCAAAGATAGGG + Intergenic
1065522867 10:26588994-26589016 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065527547 10:26638246-26638268 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065528793 10:26648266-26648288 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065558110 10:26936731-26936753 CCAGAAGACACCCAAAGGTAGGG - Intergenic
1065911974 10:30315354-30315376 ACAGAATAAACCCAAACAGAGGG + Intronic
1066526929 10:36291275-36291297 ACAGAACATACCCAAACCAATGG - Intergenic
1066690078 10:38017705-38017727 ACAGAATAAACACAAAACAAGGG - Intronic
1067036344 10:42922086-42922108 CCAGAAGAAACTTAAAGAGACGG - Intergenic
1067220858 10:44343332-44343354 ACAGAAGAAAGCCATGGCAATGG + Intergenic
1067264643 10:44728682-44728704 ACAAACTAAACCCAAAGCAAAGG - Intergenic
1067484721 10:46637719-46637741 ACTGGAGAAACCCAAAGGGAAGG - Intergenic
1067510974 10:46894885-46894907 ACAGAAGAATTATAAAGAAAGGG - Intergenic
1067610037 10:47703930-47703952 ACTGGAGAAACCCAAAGGGAAGG + Intergenic
1067651277 10:48156977-48156999 ACAGAAGAATTATAAAGAAAGGG + Exonic
1068170540 10:53387613-53387635 GCAAAAAAAACACAAAGAAATGG - Intergenic
1068551744 10:58415123-58415145 ATTAAAGAAACCCACAGAAATGG + Intergenic
1068694051 10:59946891-59946913 AAAGAAGAAAACGAAAGAAAGGG + Intergenic
1069097847 10:64281484-64281506 ACAGAACATACCCTATGAAATGG - Intergenic
1069522896 10:69139726-69139748 CAAGAAGAAAACCAAAGCAAAGG - Intronic
1069560951 10:69428970-69428992 AAGGAAGAAACCCAGACAAAAGG + Intergenic
1069730901 10:70611896-70611918 ACAGAAGAAGCCCAAACAAAAGG - Intergenic
1070033152 10:72696521-72696543 ACAGAAGACAACAATAGAAAAGG - Intronic
1070053460 10:72911692-72911714 GCAGTAGAAACCAACAGAAAAGG - Intronic
1070342300 10:75509031-75509053 AAAGAAGAAACAAAGAGAAAAGG - Intronic
1070530586 10:77333438-77333460 AGAGAAGAAAAGAAAAGAAAAGG + Intronic
1070580393 10:77714624-77714646 AAAGAAGAAGCTCAAAGAATTGG + Intergenic
1071556446 10:86606481-86606503 AGAAAAGAAAACCAATGAAATGG - Intergenic
1071625621 10:87165550-87165572 ACTGGAGAAACCCAAAGGGAAGG + Intronic
1071664317 10:87539367-87539389 GCAGAAGTATCCCAAAGAAAAGG - Intronic
1071812935 10:89203380-89203402 AGAAAAGAAAGCCAAGGAAATGG + Intergenic
1071847884 10:89538185-89538207 GCAGAAGAAAAGCAAAGCAAAGG + Intronic
1071876945 10:89852563-89852585 ACAGAAAAAACTCTCAGAAATGG + Intergenic
1072578698 10:96721812-96721834 ACAGAAGAGAGTCAGAGAAAGGG - Intergenic
1072598544 10:96900417-96900439 ATAGAATAAACCCAAAGAAATGG + Intronic
1072960821 10:99927336-99927358 GCAGATAAAACACAAAGAAATGG + Intronic
1073747514 10:106486315-106486337 ATAGAAGAAAAACACAGAAAAGG - Intergenic
1074114893 10:110448539-110448561 ACAGAAGAGACCCTAAGTAGGGG + Intergenic
1074961742 10:118452303-118452325 AAAGAAGAAAACCAAAGCAGTGG + Intergenic
1075029241 10:119010658-119010680 ACAAAAAAAACCTAAATAAAAGG - Intergenic
1075048047 10:119161564-119161586 ACAGAACAAATCAAAATAAATGG + Intronic
1075600520 10:123764772-123764794 ACAGAAGAAACCCAAAGAAAGGG - Intronic
1075752467 10:124784290-124784312 ACAGAAAAATCCCAAAAACATGG + Intronic
1076163876 10:128267013-128267035 AAAGAAGAAACCAAAGGAGAAGG - Intergenic
1077314030 11:1908252-1908274 ACAGGAGAAACACGAAGGAACGG - Intergenic
1077690873 11:4341162-4341184 AGAGAAAAAACACAAAGACATGG - Intergenic
1078475196 11:11623266-11623288 AGAGCACAAAACCAAAGAAAGGG + Intergenic
1078972234 11:16427179-16427201 AAAGAAGCAACCTAAAGAATGGG + Intronic
1079050348 11:17150836-17150858 ATAAAAGAAACCCAAGGAAAAGG + Intronic
1079976929 11:27103389-27103411 AAAGAAGAAGCCCAAAGCAAAGG - Intronic
1080881192 11:36322490-36322512 CCCAAAGAAACCAAAAGAAATGG - Intronic
1081018341 11:37910181-37910203 ATACAAAGAACCCAAAGAAAAGG + Intergenic
1081282527 11:41227295-41227317 GCAGACGGAACCTAAAGAAATGG + Intronic
1081387837 11:42493205-42493227 ACAGATAAAACTAAAAGAAAAGG - Intergenic
1081404265 11:42678272-42678294 ACAGGCAAATCCCAAAGAAAAGG - Intergenic
1081652730 11:44835159-44835181 AAGGAAGAAACACACAGAAAAGG + Intronic
1082094924 11:48122111-48122133 AGAGAAAAGAGCCAAAGAAATGG + Intronic
1083505179 11:63149983-63150005 ACAGAACAAAAACAGAGAAAAGG + Intronic
1083568281 11:63739518-63739540 ACATAGCACACCCAAAGAAAAGG + Intronic
1083788752 11:64970689-64970711 AAAGAAGAAAGAAAAAGAAAAGG + Intronic
1083982648 11:66185929-66185951 ACAGAAAAACCACAAAGAAGAGG + Intronic
1085168345 11:74425017-74425039 AAAGAAGAAAAGAAAAGAAAAGG + Intergenic
1085247114 11:75111274-75111296 ACAAAAAAAAGCCAATGAAAGGG + Intronic
1085361812 11:75895180-75895202 AAAGAAGAATGCCAAAGAACTGG - Intronic
1085424616 11:76393111-76393133 AAACAAGAAGCCCAAGGAAAAGG + Intronic
1085933403 11:81113966-81113988 CCAGAAGAAGCCCAAAGTAAAGG + Intergenic
1086049318 11:82570112-82570134 ACAGCAGAAACCTACAGAATGGG - Intergenic
1086076093 11:82854498-82854520 TCAGAAACAACACAAAGAAATGG + Intronic
1086225378 11:84502030-84502052 AGAAAAGAAAGGCAAAGAAAAGG - Intronic
1086590898 11:88512317-88512339 ACACCAGACACCCAGAGAAATGG + Intronic
1086741083 11:90369703-90369725 AATGAAGAAATCCACAGAAAAGG - Intergenic
1087140807 11:94763998-94764020 AAAGAAGAAATTAAAAGAAAAGG + Intronic
1087837130 11:102886462-102886484 AGAAAAGAAAACAAAAGAAAAGG + Intergenic
1088199935 11:107321227-107321249 ACAGAATAAACCCTCAGAGAAGG + Intergenic
1088350181 11:108877955-108877977 ACAGAAGCAAGATAAAGAAAAGG - Intronic
1088420916 11:109645710-109645732 ACAAAGAAAAGCCAAAGAAAGGG + Intergenic
1088532193 11:110822381-110822403 ACAGTAGAAGCCCAAAGAGGTGG - Intergenic
1088611137 11:111578172-111578194 ACAAAAGAAAGAAAAAGAAATGG - Intergenic
1088643829 11:111899428-111899450 ACTGAAGAAAAACAAAGAAGAGG - Intergenic
1088768386 11:113008314-113008336 AAGGAAGAAAGCCATAGAAATGG - Intronic
1089014258 11:115153835-115153857 CCAGAGGCAAGCCAAAGAAAAGG + Intergenic
1089050894 11:115544944-115544966 TCAGAAGAAGGCCAAGGAAAAGG + Intergenic
1089143646 11:116308390-116308412 AAAGAAAAAACTCAAAGAGAAGG + Intergenic
1089231787 11:116983774-116983796 ACTGAAGAAAAGCAAAGCAAAGG + Intronic
1090521211 11:127481388-127481410 ACAGAAAACACTCAGAGAAAGGG - Intergenic
1090866721 11:130707354-130707376 TCATAAGAAACCCAAACAGAAGG - Intronic
1091598498 12:1899274-1899296 ACAAAATAAACCCAAAGAAAGGG + Intronic
1091786883 12:3248359-3248381 ACAGCAGCAGCCCCAAGAAAGGG - Intronic
1092245753 12:6863449-6863471 ACAGGAGAAACACAAAGGACAGG - Intronic
1093235705 12:16606414-16606436 ACATAATACAGCCAAAGAAAAGG + Intronic
1093359611 12:18207372-18207394 AGAGAAGAAAGAAAAAGAAAGGG + Intronic
1093665661 12:21810051-21810073 ACAGCAGTAACCAAAACAAATGG - Intronic
1093855971 12:24102919-24102941 ACAGAACAAAGAAAAAGAAAGGG + Intergenic
1093864949 12:24215257-24215279 AAATAAGAAACAGAAAGAAAAGG + Intergenic
1094652029 12:32388096-32388118 ACAGTGGAAACCAATAGAAATGG + Intergenic
1095234130 12:39776924-39776946 AAAGAAAAAACCCATAGGAATGG - Intronic
1095327904 12:40920221-40920243 ACAGAGGCAACCAAAAGAAAGGG + Intronic
1095796609 12:46225901-46225923 ACAGAATAAAAGGAAAGAAATGG + Intronic
1096328849 12:50691007-50691029 ACATAAGAAACACAATAAAATGG - Intronic
1096682642 12:53267051-53267073 AAAAAAGAAAACCAAAAAAAAGG - Intergenic
1096908257 12:54956475-54956497 ACACAGGAAACCAATAGAAAGGG + Intronic
1097867154 12:64568405-64568427 ATAGAAGAAAGGCAAACAAATGG - Intergenic
1098427776 12:70384894-70384916 AAAGAAGAAAAAGAAAGAAAAGG + Intronic
1099243925 12:80172171-80172193 AAAGAAAACAGCCAAAGAAAAGG - Intergenic
1099277375 12:80594092-80594114 AAAGAAGAAAACCAAATAGAGGG + Intronic
1099701995 12:86096335-86096357 ATAGAAGAATACCAAAGTAAAGG - Intronic
1099814512 12:87627855-87627877 AAAAAAGAAACACAAACAAATGG - Intergenic
1100119037 12:91346530-91346552 ACAGAAGTAGCACATAGAAAAGG + Intergenic
1100371080 12:93969162-93969184 ACAGAGGAAACCCACAGAAGAGG - Intergenic
1100464941 12:94836184-94836206 GAAGGAGAAAACCAAAGAAAAGG - Intergenic
1100502983 12:95192328-95192350 ACAGTAGAAGACCAAGGAAAGGG + Intronic
1100641088 12:96482971-96482993 ACAGCAGAAAGTCCAAGAAAAGG + Intergenic
1100936794 12:99678909-99678931 ACAGAGGACACACAAAAAAATGG + Intronic
1101020985 12:100553642-100553664 AAACAAGAAACCCAGAGGAAGGG + Intronic
1101451489 12:104783461-104783483 ACAAAAACACCCCAAAGAAATGG + Intergenic
1101671591 12:106880160-106880182 ACAAAGGAAAACCAAAGCAATGG - Intronic
1101703763 12:107200475-107200497 ACAAAAGAAAGGCAAGGAAAGGG - Intergenic
1101986002 12:109447637-109447659 CCAGAAGAAACCCAGAGACATGG - Exonic
1102166547 12:110811343-110811365 ACAAAAAAAACCAAAGGAAATGG + Intergenic
1102267324 12:111498028-111498050 ACAAAAAAACCCCAAAGAACTGG + Intronic
1102499562 12:113342225-113342247 AAAGAAGAAAAAGAAAGAAAGGG + Intronic
1103312029 12:120017995-120018017 AAAGATGAAACCAAAGGAAACGG - Intronic
1103427276 12:120847170-120847192 ACAAAATAAACCAGAAGAAAGGG + Intronic
1104529759 12:129558348-129558370 CCAGATGAAACCCATAGGAATGG - Intronic
1104763778 12:131313646-131313668 ACACAAGAAACTCCAAGAAAGGG + Intergenic
1104900249 12:132186161-132186183 AAAGAAGAAAGAAAAAGAAAAGG - Intergenic
1105941164 13:25149258-25149280 ACTGAAGCTACACAAAGAAAAGG - Intergenic
1106435346 13:29718747-29718769 ACAAAAGAAACCCTGAGGAATGG + Intergenic
1106461248 13:29972146-29972168 ACTGCAGAAAACCAAAGACAAGG - Intergenic
1106741031 13:32641617-32641639 ACAGAAGAAAGTCAAGAAAATGG - Intronic
1106745471 13:32700669-32700691 ACATAATAAACAAAAAGAAAGGG - Intronic
1106883605 13:34158741-34158763 TCCAAAGAAACCCAAAGTAAAGG - Intergenic
1107062942 13:36180299-36180321 ACAAAATAAACCCAAATAAGTGG - Intronic
1107259031 13:38468689-38468711 ACTGAAGAAAGCCAATGACATGG - Intergenic
1107339714 13:39393354-39393376 GCAGAAACAACCCAAAGACAAGG + Intronic
1107397252 13:40030614-40030636 ACAGAAGGAAGAGAAAGAAATGG - Intergenic
1108223935 13:48268255-48268277 ACACACAAAACCAAAAGAAATGG - Exonic
1108888043 13:55214484-55214506 ATAAAAGAAACCAAAAGAAAAGG - Intergenic
1109149489 13:58827205-58827227 ACAGCAGAAACTCAGAAAAAGGG + Intergenic
1109267509 13:60218007-60218029 ACAGAAGAAAGGCAAAGCTATGG + Intergenic
1109860245 13:68189061-68189083 ACTGATGAAAGTCAAAGAAAAGG + Intergenic
1109991034 13:70057813-70057835 AGAAAAGAAAAACAAAGAAAAGG + Intronic
1109992654 13:70079533-70079555 ACTGATGAAACTAAAAGAAAAGG - Intronic
1110121640 13:71888903-71888925 ACAGAACAAACCAAAAGAAATGG + Intergenic
1110218684 13:73050676-73050698 AGAGAAGAAACCAACAGAGAGGG + Intergenic
1110292945 13:73827962-73827984 ACAGAAAAACCCAAAAGGAAAGG - Intronic
1110438116 13:75497587-75497609 AAGGAAGAAAACCAAAGCAATGG + Intergenic
1111127660 13:83932525-83932547 ACTGCAGAAAACCAAAGACAAGG + Intergenic
1111727061 13:92025102-92025124 AAAAAAGAAACAAAAAGAAAGGG - Intronic
1111735092 13:92128120-92128142 CCAGAGGAAACCCGAAGAATAGG - Intronic
1111879940 13:93943760-93943782 AAAGCAAAAACCCCAAGAAATGG + Intronic
1112057340 13:95702280-95702302 ACAGAAGAAAATCAAAATAATGG - Intronic
1112389944 13:98974019-98974041 ACAAAAGGAACCCAATGAAAGGG + Intronic
1112976944 13:105331932-105331954 ACAACAGAAAAGCAAAGAAAGGG + Intergenic
1113081222 13:106522559-106522581 ATTGAAAAAACTCAAAGAAATGG + Intronic
1113152376 13:107279024-107279046 AAAGAAGAAAAGAAAAGAAAAGG - Intronic
1113350078 13:109520586-109520608 AAAGAGTAAACACAAAGAAATGG - Intergenic
1114460413 14:22883037-22883059 AGAGAAGCGACACAAAGAAAAGG + Intergenic
1114507592 14:23230314-23230336 ACAGAAGAAAAATAAATAAAAGG - Intronic
1115213013 14:30987146-30987168 ACAGTAAAACTCCAAAGAAAGGG + Intronic
1115470907 14:33767473-33767495 ACAGAGGAAAAAAAAAGAAAAGG + Intronic
1115695108 14:35888655-35888677 GAAGAAGAAAACCAAAGTAAAGG + Intronic
1116497078 14:45574219-45574241 ACAGAAGGATCACAGAGAAAGGG - Intergenic
1116599276 14:46898677-46898699 AAAGAACACAACCAAAGAAAGGG + Intronic
1116907752 14:50421778-50421800 AAACAAGCAACCCAGAGAAACGG + Intronic
1117558531 14:56911285-56911307 ACATCAAAATCCCAAAGAAATGG + Intergenic
1117958069 14:61137953-61137975 ACAGTAGAGACACAGAGAAAGGG + Intergenic
1118111839 14:62730534-62730556 ACAGAAGGAAACTAAAGAAGAGG - Intronic
1118820791 14:69344464-69344486 ATAGAAGAGACCCATAGAGAAGG + Intronic
1120668464 14:87335606-87335628 ACAGAAGTAACTTACAGAAAGGG - Intergenic
1120777381 14:88452502-88452524 GCAGAAGAACTCCAAAAAAAAGG - Intronic
1121135334 14:91492700-91492722 AGAAAAAAAGCCCAAAGAAATGG - Intronic
1121475238 14:94194556-94194578 CTAGAAGAAACCCAAAAAAATGG - Intronic
1121509948 14:94505170-94505192 AAAGCAGCAACCCAAAGGAAGGG - Intronic
1121847619 14:97186969-97186991 AGAGGAGAAACTCAAAGAATTGG - Intergenic
1123699726 15:22905339-22905361 CAAGAAGAAAACCAAAGCAACGG - Intronic
1124124141 15:26922595-26922617 AAAGCAGAAAGCCAAAGAAATGG - Intronic
1124493141 15:30170684-30170706 ACACAAGGAACTCAAAGAAATGG - Intergenic
1124750393 15:32367641-32367663 ACACAAGGAACTCAAAGAAATGG + Intergenic
1124793951 15:32757725-32757747 ACAGAAGACACCAAAAAAAATGG - Intergenic
1125012526 15:34895287-34895309 ACAGAAGAATACAAAATAAAGGG + Intronic
1125533078 15:40426563-40426585 TCAGAAGATACCCACAGGAATGG - Intronic
1125696183 15:41639216-41639238 AGAGAAGAAACCATAAGACAAGG - Intronic
1125718830 15:41835476-41835498 ACAGAAGAATCCCAAGAAAGGGG - Intronic
1126272895 15:46843501-46843523 AGTGAAGAAACCCACAGAATTGG - Intergenic
1126693964 15:51310397-51310419 ACAGCAACAACCCCAAGAAATGG + Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127811500 15:62569121-62569143 AGAGAAAAAACACAAAGAACAGG - Intronic
1127933232 15:63611549-63611571 CCAGAAGGAACCCAAAGATGTGG - Intronic
1128548383 15:68582317-68582339 AGAGAAGAAAGCCAGAAAAAGGG + Intronic
1128802833 15:70507827-70507849 AAAGAAGAAAAGAAAAGAAAAGG + Intergenic
1128947257 15:71835298-71835320 ACATAAGAAAAAGAAAGAAAAGG + Intronic
1129070796 15:72948983-72949005 AAAGAAGAAAAATAAAGAAAAGG + Intergenic
1130112543 15:80977645-80977667 ACAGAAAAAGCCCACAGACAGGG + Exonic
1130730948 15:86491602-86491624 ACAGAAGGGACAGAAAGAAAGGG + Intronic
1130844383 15:87730921-87730943 ACAGAATAAACCCTCAAAAATGG - Intergenic
1131197112 15:90364398-90364420 ACAAAAGAAAACTATAGAAAGGG - Intronic
1131279603 15:91009897-91009919 ACAGAGGAACTCCAGAGAAATGG - Intronic
1131309916 15:91280838-91280860 ACACAAGAAACTGATAGAAACGG - Intronic
1131656510 15:94465763-94465785 ACAGAAGAAATAAAAAGACACGG - Intronic
1132452753 15:101977290-101977312 ACAGGGGAATCCCGAAGAAATGG - Intergenic
1132454144 16:13336-13358 ACAGGGGAATCCCGAAGAAATGG + Intergenic
1133483342 16:6193733-6193755 ACCCAAAATACCCAAAGAAATGG - Intronic
1133490576 16:6264130-6264152 AGAAAAGGAACCCAAAGCAATGG - Intronic
1134176980 16:12015023-12015045 ACATAAGCAACCCAAAGGGAAGG - Intronic
1134334198 16:13280918-13280940 GAAAAGGAAACCCAAAGAAATGG + Intergenic
1134876592 16:17705362-17705384 GCAGATGAAAACCAAAGCAAGGG + Intergenic
1135191638 16:20359330-20359352 AAAGAAGAAACCAAAAGTCAAGG - Exonic
1135638891 16:24102784-24102806 ACAAAATAAACCTACAGAAAAGG - Intronic
1136041418 16:27582283-27582305 AAGGAAGAAAACAAAAGAAAAGG + Intronic
1136098570 16:27976559-27976581 ACAGAAGAGACAAACAGAAAGGG + Intronic
1136379062 16:29883298-29883320 AAAGAAGAAAAGAAAAGAAAAGG - Intronic
1137270802 16:46901251-46901273 ACTGAAGAAAGCCAGAGAAAGGG - Intronic
1137316646 16:47331502-47331524 AAAACAGAAACCCAAAGAAAAGG + Intronic
1137821796 16:51453018-51453040 CCAGAAGCAACCCAAAGACAAGG - Intergenic
1138703615 16:58892064-58892086 ACAGAAAAGACCCGCAGAAAAGG + Intergenic
1139272432 16:65696819-65696841 AAAGAAGAAAGAGAAAGAAAAGG + Intergenic
1139508424 16:67411467-67411489 ACAGAAGAGATCCAAAGAAGTGG - Intronic
1139914672 16:70420696-70420718 ACAAAAGAAAGCTAAAGATAGGG - Intronic
1140273619 16:73488205-73488227 ACTGAAGAAAGCTAAAGGAATGG + Intergenic
1140406096 16:74712638-74712660 ACAAAAGAAAACAAAACAAAAGG - Intergenic
1140541846 16:75762880-75762902 ACAGAAGAAAACCTGAGAATTGG - Intergenic
1141252494 16:82370933-82370955 TCAGAAGAAAACTGAAGAAAGGG + Intergenic
1141623286 16:85248391-85248413 ACAGAGGAAACAGAAAGAAGAGG - Intergenic
1141933891 16:87223450-87223472 TCAGCAGAAACCCAAATGAATGG + Intronic
1143696115 17:8620488-8620510 AGAGAATAAATCCAAAGAAAAGG + Intronic
1144077229 17:11730122-11730144 ACAGAACAAACCCAAAAAAAGGG - Intronic
1144592521 17:16536489-16536511 ACAAAAAAAACAAAAAGAAAAGG + Intergenic
1144627926 17:16854513-16854535 AAAGAAAAAAATCAAAGAAAGGG - Intergenic
1145159515 17:20565094-20565116 AAAGAAAAAAATCAAAGAAAGGG - Intergenic
1146553773 17:33805335-33805357 CCAGGTGAAACCCAAAGAAGGGG + Intronic
1147011719 17:37454640-37454662 ACAGAAGAAAGCATAAAAAAGGG + Intronic
1147162690 17:38577281-38577303 ACAGGAGGAACCCAATGAGAGGG + Intronic
1147502967 17:40983726-40983748 ACAGAAGGAAACCAAGGGAAAGG - Intronic
1147980167 17:44269227-44269249 GCAGAAGAAACTCAAACACAGGG + Intergenic
1147983489 17:44289963-44289985 AAAGAAGAAAAGAAAAGAAAAGG + Intergenic
1149440647 17:56671136-56671158 AGAGAAGAAAAGAAAAGAAAGGG + Intergenic
1150068986 17:62136676-62136698 ACAAAACACACACAAAGAAAAGG + Intergenic
1150133006 17:62679536-62679558 CCAAAAGGAACCCAAACAAAGGG + Intronic
1150188496 17:63212575-63212597 ACAGAATAAAAGCAAAGAACAGG - Intronic
1150892997 17:69176410-69176432 ACAAAAAAAATCTAAAGAAAAGG + Intronic
1151152461 17:72099596-72099618 ATAGAAGAAACCCTATGAGAAGG - Intergenic
1151858715 17:76742302-76742324 ACAGAAAAAAAAGAAAGAAAAGG - Intronic
1152652859 17:81503943-81503965 AAAGAAGAAAAGAAAAGAAAAGG + Intergenic
1152783031 17:82234817-82234839 GCAGGAGGAACCCAAGGAAAGGG + Exonic
1153113691 18:1627129-1627151 AGAGCAGAAAACCACAGAAAAGG + Intergenic
1153122611 18:1748071-1748093 AAAGAAGTAAGACAAAGAAAAGG - Intergenic
1153174677 18:2357536-2357558 ACAAATGAAGCCCAAAGGAAAGG - Intergenic
1154291056 18:13106934-13106956 ACAGAAAAGATCCAAAGAAAAGG - Intronic
1154942191 18:21125536-21125558 AAAGAAGAAAACAAAATAAATGG - Intergenic
1154995306 18:21635074-21635096 ACAGAGAAAACCCACACAAAGGG - Intergenic
1155076101 18:22356977-22356999 AAAGAAAGAACTCAAAGAAAGGG - Intergenic
1155230834 18:23773464-23773486 ACAAAAGAAACTTAAAGGAAGGG - Intronic
1155577278 18:27261151-27261173 GCAGAAGAACAACAAAGAAATGG - Intergenic
1155587469 18:27383806-27383828 ACAGGATATACCTAAAGAAAGGG - Intergenic
1155736989 18:29236234-29236256 ACAGAAGAGATCTAAAAAAATGG - Intergenic
1155899953 18:31376893-31376915 GCAAGAGAAACCCAAAGGAATGG + Exonic
1156092839 18:33492422-33492444 AAAGAAGAAACAGAAAAAAAAGG + Intergenic
1156497740 18:37537074-37537096 ACAGAAGAAAGCCCAGGTAAGGG - Intronic
1156609675 18:38711650-38711672 ACAGAGGAAACACAGAGATAAGG - Intergenic
1156884457 18:42118173-42118195 ACTGAAAAAACCCTAAGAAAAGG - Intergenic
1157036617 18:43982840-43982862 ACAGAAGCAGCCCACTGAAAGGG + Intergenic
1157370653 18:47108457-47108479 GAAGATGAGACCCAAAGAAAGGG - Exonic
1157491443 18:48126649-48126671 ATTGATGAAACCCAAAGCAATGG - Intronic
1157590275 18:48832457-48832479 AAAGAAGAAACACATAGAAAGGG + Intronic
1157653409 18:49360810-49360832 TAAGAGGAAACCCAAAGATATGG + Intronic
1157898829 18:51493909-51493931 TGAGATGAATCCCAAAGAAAAGG - Intergenic
1158294334 18:55978227-55978249 ACAGCAGAAACACAAAGTTAGGG + Intergenic
1158344764 18:56505085-56505107 ACAGAACCAAGCCAAAGGAAAGG + Intergenic
1158616462 18:58992277-58992299 TCAGAAGAGACCAAAATAAATGG + Intergenic
1159125833 18:64223308-64223330 TCACAAGAAAGCCAAAAAAAGGG - Intergenic
1159343144 18:67163191-67163213 ACAGAACAAAATCAAAGCAATGG - Intergenic
1159410567 18:68070224-68070246 ACAGAAGAAAACCAAATGAATGG + Intergenic
1159681340 18:71356363-71356385 ACAGAAAAAAAAGAAAGAAAAGG - Intergenic
1159697796 18:71582630-71582652 ATAGAAGAAAACAAATGAAATGG + Intergenic
1160316784 18:77855565-77855587 AGAGAAGCAACCCAAAGCAAAGG - Intergenic
1161094811 19:2384142-2384164 CCATTAGAAACCCACAGAAAAGG - Intergenic
1161225690 19:3144304-3144326 CCATGAGAAACTCAAAGAAACGG + Intronic
1161570156 19:5026111-5026133 AAAGAAGAAACCCAGGGACAGGG + Intronic
1161746174 19:6061536-6061558 ACAGAATGCATCCAAAGAAACGG + Intronic
1161906918 19:7163615-7163637 ACCCAAAAAACCCAAAGTAACGG + Intronic
1161969506 19:7569249-7569271 ACAGAACAAAACAAAACAAAAGG - Intergenic
1162855458 19:13464898-13464920 AGAAAAGAAACCAAAAGAAAAGG - Intronic
1164106482 19:22110770-22110792 GCAGAAGAAACAGAAAGGAATGG - Intergenic
1165107853 19:33484820-33484842 ACGGAAGAATCCAAAAGACAAGG + Intronic
1165290824 19:34883944-34883966 AGAGAACAAAACCAGAGAAAAGG + Intergenic
1165870218 19:38966596-38966618 GAAAAAGAAATCCAAAGAAATGG + Intronic
1167081325 19:47277916-47277938 AGAGATGAAAACCAAAGAGAGGG - Intergenic
1168173611 19:54607595-54607617 ACAGAACACACACAAAGGAAGGG - Intronic
1168492991 19:56826133-56826155 GCAGAAGAATCCCAAAGCAAGGG + Intronic
1168539790 19:57200607-57200629 AGAAAAGAAAACGAAAGAAAAGG - Intronic
1202679108 1_KI270711v1_random:35599-35621 TGAGAAGAAACCAAAAGCAACGG - Intergenic
925002346 2:415395-415417 ACAGAAGAAACTTGAAGACATGG - Intergenic
925033446 2:669598-669620 AGAGAAGAAAGGAAAAGAAAAGG - Exonic
925094137 2:1181507-1181529 TCACAAGAAACCCAGAGGAATGG + Intronic
925471744 2:4169731-4169753 TCAGAAGAAACCAAAAGGGATGG - Intergenic
925501571 2:4510952-4510974 AAATAAGAAAACTAAAGAAAAGG + Intergenic
925811264 2:7703084-7703106 AAATATGAAACTCAAAGAAAGGG + Intergenic
925875085 2:8304487-8304509 ATAGAAGAAAATAAAAGAAAAGG + Intergenic
926030196 2:9579799-9579821 TCAGAAGAAAAAAAAAGAAAAGG - Intergenic
927060639 2:19416261-19416283 AGAAAAGAAACAGAAAGAAAGGG - Intergenic
928001147 2:27523966-27523988 ACATAGGAAACCCAGAAAAAGGG + Intergenic
928115159 2:28540860-28540882 ACAGAAGAGACCCCAAGAGAGGG + Intronic
928273030 2:29874210-29874232 AGAGAAGAAAGCCATAGAGAAGG - Intronic
929071981 2:38039925-38039947 ACAGGAGAAAACCAAAGAGGAGG - Intronic
929091927 2:38226122-38226144 ACTGCAGAAAACCAAAGATATGG + Intergenic
929163331 2:38855544-38855566 ACACATGAACCCCAAAGAAAAGG + Intronic
929388037 2:41434606-41434628 ACTGATGAAACACAAAGCAAAGG - Intergenic
929439311 2:41952840-41952862 AGAGAAGATACCCAAAGAGCAGG + Intronic
929616213 2:43310778-43310800 ACAGTAAAAATCCACAGAAAGGG + Intronic
929958556 2:46479281-46479303 AAAAAAGGAACCCAAGGAAATGG + Intronic
930372549 2:50522097-50522119 AGAGAAGAAACTCAAAACAATGG + Intronic
930397049 2:50835348-50835370 ACATAAGAAATCGAAAGTAAAGG - Intronic
930795930 2:55390772-55390794 AGAAAAGAATACCAAAGAAAAGG + Intronic
930847995 2:55926068-55926090 AAAAAAGAAACCCATAAAAAGGG - Intergenic
930923334 2:56784550-56784572 ACAGAAGAAAGACAGGGAAAAGG - Intergenic
931252075 2:60541025-60541047 ACAGAATAAACACAGAGAACGGG + Intronic
932632742 2:73359962-73359984 ATAAAAGAAAACCAAAGCAAGGG - Intergenic
932694572 2:73944510-73944532 ACAGGAGAAAACAAAAGATACGG - Intronic
932782820 2:74572855-74572877 ACAGAAGACTAACAAAGAAAAGG + Intronic
933067653 2:77818381-77818403 AGAAAAGAAAACAAAAGAAAAGG - Intergenic
933594836 2:84273011-84273033 ACAGAAGAAACTCAGAGTTAGGG + Intergenic
933866234 2:86520733-86520755 ACAGAACAAAACAAAACAAAAGG + Intronic
934056634 2:88256892-88256914 AAAGAAGAAAAGAAAAGAAAAGG - Intergenic
935729318 2:106051977-106051999 GGAGGAGAAACCCAATGAAAGGG + Intergenic
935793803 2:106619551-106619573 AAATAAGAAAACCAAATAAAAGG - Intergenic
935914342 2:107933213-107933235 GCAGAAGAAACCCAAGTAACTGG + Intergenic
936044845 2:109179457-109179479 ACAGAAAACACACAAAGACAAGG - Intronic
936269481 2:111037845-111037867 ACAGATGAATCCCAGAGAATGGG + Intronic
936504189 2:113092018-113092040 AAAGAAGAAAGGAAAAGAAAAGG + Intergenic
936598117 2:113868801-113868823 AGAGAAGAAAAGAAAAGAAAAGG + Intergenic
936648770 2:114402593-114402615 ACATAAGCCACCCACAGAAAGGG + Intergenic
937051052 2:118890234-118890256 AAAGAAGACAGCCAAAGCAATGG + Intergenic
937478840 2:122238896-122238918 ACTGAAGAGACCCAGGGAAAAGG - Intergenic
938725299 2:134103495-134103517 AGTGAAGAATCTCAAAGAAAAGG + Intergenic
939451758 2:142383410-142383432 GAAGAAGAAACACAAAGAAAGGG - Intergenic
939841219 2:147189120-147189142 AGAAACAAAACCCAAAGAAATGG + Intergenic
940595232 2:155783011-155783033 TCAGAGGAAACCCAAACAAATGG + Intergenic
941193969 2:162423223-162423245 AGAGAAGAAAACAAAAGCAAGGG + Intronic
941641931 2:167998082-167998104 AAAGAATAAACCCAATTAAAGGG + Intronic
941923197 2:170871792-170871814 AGAGAACAAAAACAAAGAAAAGG + Intergenic
942037789 2:172027921-172027943 ACTGAAGAGACCTAAAGAAAGGG + Intronic
942456719 2:176143132-176143154 AGAGAAGAGACCAAAACAAAAGG - Intergenic
942910553 2:181238203-181238225 AGAGAAAAAATCCAAATAAACGG + Intergenic
943501238 2:188692357-188692379 ACAGAAGAAAAAGAATGAAAAGG - Intergenic
944053557 2:195498560-195498582 ACAGAAGAAAAACAAATACAGGG + Intergenic
944087514 2:195866736-195866758 AAAGAAAAAACAAAAAGAAATGG - Intronic
944693188 2:202176713-202176735 GAAGAAGAAACACAAATAAATGG + Intronic
944706162 2:202291025-202291047 AAAGTAGAAAGCCAATGAAAAGG - Intronic
944813465 2:203350836-203350858 ACACAACAAAAACAAAGAAAAGG - Intronic
944967012 2:204946446-204946468 ACAGAAAAAATGGAAAGAAAGGG - Intronic
945096191 2:206221845-206221867 ACAGAAGAAACCCAATGAACCGG - Intergenic
945149900 2:206779522-206779544 ACAGAAGAGAGCAAGAGAAAGGG + Intronic
945921159 2:215756024-215756046 GCAAAAGAAAGACAAAGAAAAGG - Intergenic
945924866 2:215793133-215793155 AGAAAAGAAAACAAAAGAAAAGG - Intergenic
945966296 2:216190796-216190818 ACAGACAAAACCCACACAAAAGG - Intronic
946071524 2:217038290-217038312 AAAGAAGATACCAAAATAAAAGG - Intergenic
946110158 2:217408018-217408040 ACAAAAAAACCCCAAAAAAACGG - Intronic
946387591 2:219394376-219394398 CCAGAAGAGACCCAAAGGAGTGG - Intronic
946498673 2:220222268-220222290 GCAGAAGAAAGCAAAAGAAAAGG + Intergenic
946564097 2:220944093-220944115 AAAGAAGAATCCCAGAGATAAGG + Intergenic
946584095 2:221164269-221164291 GCAGAAAAAACCCAAAGAAATGG - Intergenic
946682947 2:222236456-222236478 ATAGATGAAATCCAAAAAAATGG - Intronic
947273962 2:228370671-228370693 ACAAAAGCAACCAACAGAAATGG + Intergenic
947316770 2:228867133-228867155 AAAGAAAAAATCCTAAGAAATGG - Intronic
947423772 2:229963742-229963764 ACATAAGAAACACAAAGGATAGG - Intronic
947662589 2:231880794-231880816 AGAGCAGACACACAAAGAAAGGG - Intergenic
948124382 2:235554283-235554305 AAATAAGAAACCCAAATAAATGG - Intronic
948233923 2:236372936-236372958 AAAGAAGAAAATCAAAGCAAAGG - Intronic
948306247 2:236949136-236949158 AAAGAAGAAACCAAAATGAATGG + Intergenic
948422158 2:237866305-237866327 ACAAAAGAAACACACAGAAGAGG - Intronic
948501725 2:238399182-238399204 ACAGCAGAAACACAAAGAACAGG - Exonic
948570819 2:238916022-238916044 ACAGAAGAAGCACAGAGGAAGGG + Intergenic
948617234 2:239208020-239208042 ACACAAGAAAACACAAGAAAAGG + Intronic
948678454 2:239612800-239612822 ACAGAAGAATTACAAAGAATTGG - Intergenic
949079609 2:242086254-242086276 ACAGCAGAAACCTACAGAACAGG - Intergenic
1168969313 20:1919891-1919913 AGAGCAGAAACACCAAGAAAAGG - Intronic
1169021332 20:2333343-2333365 ACCTTAGAAACTCAAAGAAAGGG + Intronic
1169054208 20:2606653-2606675 AAAGAAGAAAACCCAAAAAAGGG - Intronic
1169361273 20:4951328-4951350 TCAGAAGTAAGCCAGAGAAATGG + Intronic
1170988284 20:21278458-21278480 AAAAAAGAAAGACAAAGAAAAGG + Intergenic
1171769620 20:29312518-29312540 AAAGAAGAAAAGAAAAGAAAAGG + Intergenic
1172237420 20:33387716-33387738 ATATAAGAAAACCACAGAAAAGG + Intronic
1172367709 20:34362771-34362793 AAAGAAGAAAAAAAAAGAAAAGG + Intergenic
1172394616 20:34592286-34592308 ACAGAATAAACCCCAAAAGAAGG + Intronic
1172812241 20:37656886-37656908 TCAGCAGAAACCCAAAGGACAGG - Intergenic
1173324689 20:42021918-42021940 AAAGAAGAGACCCAAAGAGAAGG - Intergenic
1173379115 20:42522076-42522098 AAAGAAGAAACCCAAAGCAAAGG - Intronic
1173546241 20:43900407-43900429 AAAAAAAAAACCCAAAAAAACGG + Intergenic
1173671220 20:44800306-44800328 CCAGAGGACATCCAAAGAAATGG - Intronic
1173953291 20:47010390-47010412 CCTGAAGAAACCCAGAGGAAGGG - Intronic
1174309369 20:49639104-49639126 ACAAAATAAACTCAATGAAATGG + Intronic
1175278087 20:57785511-57785533 ACAGGAGAAAATCACAGAAAAGG - Intergenic
1175570047 20:60011612-60011634 ACAGATGATACACAAATAAACGG + Intronic
1175708960 20:61203803-61203825 TGGGAAGAAACCCAAAGAAAGGG + Intergenic
1176198935 20:63851187-63851209 TAAGAAGGAAGCCAAAGAAAGGG - Intergenic
1176643811 21:9330757-9330779 AAAGCAGAAACCCAAAACAATGG - Intergenic
1177113992 21:17063570-17063592 AAAGAAGAAATACAAAAAAAAGG - Intergenic
1177179879 21:17733769-17733791 ACAGAACAGACTAAAAGAAATGG - Intergenic
1177352628 21:19964128-19964150 ACAGAAGAAGACAAAGGAAAAGG - Intergenic
1177720448 21:24899822-24899844 ACATAAGTAATCCATAGAAACGG - Intergenic
1177917860 21:27113264-27113286 ACAGAAGAAACAAAAATACAAGG - Intergenic
1177960141 21:27654204-27654226 ACAGAAGAAATCAAACCAAAAGG - Intergenic
1178210667 21:30527796-30527818 AAAGAAGAAACGTAAATAAAGGG + Intergenic
1178322258 21:31614694-31614716 AGAGAAGAAAAGAAAAGAAAGGG + Intergenic
1178364970 21:31982516-31982538 AAAGAGGAAACCAAAAGAGAAGG - Intronic
1178449295 21:32679839-32679861 TCAAAAGGAACCCAGAGAAAAGG + Intronic
1178473373 21:32915179-32915201 ACACAAGAAACCACTAGAAAAGG + Intergenic
1179005789 21:37512957-37512979 ACAGAACAAAACAAAAAAAAAGG - Intronic
1179029579 21:37709134-37709156 ACAGAAGAACCTTAAAGGAAAGG + Intronic
1179402155 21:41094242-41094264 CCAGTAAAAACCCAGAGAAAAGG + Intergenic
1180090745 21:45532865-45532887 ACAGAAGACACAGAAAGGAAGGG + Intronic
1180420511 22:12810304-12810326 AAACAAGAAACCCAAAACAATGG + Intergenic
1181554223 22:23658406-23658428 AAAAAAGAAAACAAAAGAAACGG - Intergenic
1181569124 22:23757642-23757664 AAAGAAGAAAAGAAAAGAAAGGG - Intergenic
1182940732 22:34274666-34274688 AGAGAAGAAACCAGAAGCAAAGG + Intergenic
1183019570 22:35016403-35016425 ACAGAAGAACCCAAAGGAAATGG + Intergenic
1184039872 22:41936513-41936535 CCAGAAGGAACCTACAGAAAGGG + Intergenic
1184940780 22:47763229-47763251 ACAGTAGGAACTCAATGAAAGGG + Intergenic
1184983309 22:48111551-48111573 ACAGAAGATATGCAAATAAATGG + Intergenic
1185028667 22:48430109-48430131 ACAGAGGAAACCCAAAGGAAAGG + Intergenic
1185397992 22:50602155-50602177 ACAGAGGGCACCCAAAGCAAAGG - Intronic
949578315 3:5360693-5360715 AAAGAAGAAAGAAAAAGAAAAGG - Intergenic
949720022 3:6978180-6978202 GCAGAAGAGACACAGAGAAAAGG + Intronic
949830022 3:8204385-8204407 ACCAAATAAAGCCAAAGAAATGG - Intergenic
949979075 3:9488767-9488789 ACAGAAGACAGGCAAAGAAGAGG + Intergenic
950086676 3:10263718-10263740 ACAGAAGAGATCAAAAGAAACGG - Intronic
950180257 3:10907438-10907460 AAAGAAGAGACCCAAAGCAATGG + Intronic
950513893 3:13451263-13451285 ACAAAAGAAAACAAAAAAAAGGG + Intergenic
950864685 3:16179732-16179754 ACAGAACAAACTCAATGAAATGG + Intronic
951002519 3:17580371-17580393 ACAGAAGAAGCCTAAAGAAGTGG + Intronic
951120127 3:18916906-18916928 TCAGTAGAAGCCCAAAGAAGAGG + Intergenic
952214786 3:31267546-31267568 ACAGAGGAAACACAAAGGAATGG - Intergenic
952311824 3:32197478-32197500 AAAGAAGAAAAGAAAAGAAAAGG + Intergenic
952673840 3:36001975-36001997 AGAGAAGAATGCCAAAGAGAAGG - Intergenic
952731634 3:36642975-36642997 TAAGAAGAAACCAAAAGCAATGG - Intergenic
953163088 3:40440310-40440332 AAAGAAAAAACACAAAGAAATGG + Intergenic
953177037 3:40562188-40562210 ACAGTAGAGACACAGAGAAAGGG - Intronic
953308417 3:41852587-41852609 AAAGAAGAAAACTGAAGAAAAGG + Intronic
953473552 3:43186598-43186620 ACACTAGAATGCCAAAGAAATGG - Intergenic
954694153 3:52411446-52411468 ACAGAACAAGCACAAAGAAGGGG + Intronic
954827630 3:53388871-53388893 GCAAAAGAAGACCAAAGAAAGGG + Intergenic
954998198 3:54901289-54901311 AAACTAGAAACCCAAAGAAAGGG - Intronic
955322300 3:57983015-57983037 AGAGAAAAAAATCAAAGAAAAGG - Intergenic
955895140 3:63691191-63691213 AAAAGAGAAATCCAAAGAAAGGG + Intergenic
956218449 3:66875182-66875204 CCTGAAGAAACTCTAAGAAATGG + Intergenic
956234333 3:67051885-67051907 AAATAGGAAACCCAAATAAAAGG + Intergenic
956525553 3:70155660-70155682 ACAGCAGAATCTGAAAGAAAGGG - Intergenic
956923438 3:73955415-73955437 ACAAAAAAAAACTAAAGAAAAGG - Intergenic
956936815 3:74111574-74111596 ACAGAAAGAAAACAAAGAAAAGG - Intergenic
957380103 3:79416635-79416657 AAAAAAGAAAACAAAAGAAAGGG + Intronic
957504050 3:81096935-81096957 ACGGAAGAAAGCCAATAAAAGGG + Intergenic
957650034 3:82989163-82989185 ACAGAAAGGCCCCAAAGAAAAGG + Intergenic
957813805 3:85264479-85264501 AAAGAATAGTCCCAAAGAAAAGG - Intronic
957907376 3:86575144-86575166 ACACAACAAACCCAAATATATGG - Intergenic
958600727 3:96293426-96293448 ACAGAAGAAGCTCAAACAGAGGG + Intergenic
959181187 3:102982542-102982564 AAAGAGGAAACCTAAGGAAAAGG - Intergenic
959336333 3:105069774-105069796 AAAGAACCAACCCAAAGAATGGG + Intergenic
959384554 3:105686207-105686229 ATAAAACAAACCCAAACAAATGG + Intronic
959851987 3:111098091-111098113 ACAGATTAAAACCAAAGAAAAGG - Intronic
960300027 3:115991732-115991754 GCAGTAGAAACCCCAAAAAAAGG + Intronic
961751344 3:129096785-129096807 AGAGAAAAAATACAAAGAAATGG + Intronic
961912707 3:130337045-130337067 TTAGTATAAACCCAAAGAAAAGG + Intergenic
961914208 3:130354092-130354114 AAAGAAGAAAGAGAAAGAAAGGG + Intronic
962212209 3:133488334-133488356 ACAGAAAAAAGAGAAAGAAAGGG + Intergenic
962704135 3:138027025-138027047 GGAGAAGAGACCCACAGAAACGG + Intronic
963308419 3:143679864-143679886 ACAGAAGAAAATTAAATAAAAGG + Intronic
963388819 3:144631862-144631884 AAAGAAGAGAGCCAGAGAAATGG + Intergenic
963457477 3:145564002-145564024 AATGAACAATCCCAAAGAAATGG - Intergenic
964002776 3:151796067-151796089 ACAAAAGAAAAGAAAAGAAAAGG + Intergenic
964105992 3:153040377-153040399 ACACAAAAAACACACAGAAATGG - Intergenic
964411982 3:156407362-156407384 GCAGGAGAAAGGCAAAGAAAAGG - Intronic
964574529 3:158150327-158150349 ATAGCATAAAACCAAAGAAAAGG + Intronic
964635742 3:158857017-158857039 ATACAAGAAGCCCAAAGAACGGG - Intergenic
964945577 3:162219624-162219646 ACAAGAGAATCCCAAATAAAGGG - Intergenic
965636172 3:170783338-170783360 TCAGAAGCAACACAAACAAATGG + Intronic
966485682 3:180466973-180466995 AAAGAAGACACCAAAAAAAATGG - Intergenic
967414677 3:189202910-189202932 TTAGAAGAAAAGCAAAGAAACGG - Intronic
967936741 3:194734572-194734594 AAAAAAAAAACCCAAAAAAAAGG + Intergenic
1202743075 3_GL000221v1_random:74309-74331 AAAGCAGAAACCCAAAACAATGG + Intergenic
968624523 4:1621046-1621068 AAAGAAGGAACACAAAGAACAGG + Intronic
968793473 4:2685887-2685909 AAAGAAGTAATCCATAGAAAAGG - Intronic
968808604 4:2790167-2790189 ACAGAATAAGGCCAAAGAGAAGG - Intergenic
969040463 4:4291510-4291532 ACAGAAGGAATTCACAGAAATGG + Intronic
969236914 4:5871854-5871876 ACAGAAGAGACCGTAGGAAATGG + Intronic
969868058 4:10088036-10088058 ACAGAAGGAGCCCAGAGAGAGGG + Intronic
970299992 4:14671118-14671140 AGAGCAGAAACCCAAAGCAATGG - Intergenic
970641019 4:18066132-18066154 AGAGAAGAAAAGAAAAGAAAAGG - Intergenic
970669640 4:18381186-18381208 ACAGAAAAAAACAAAGGAAAAGG - Intergenic
970925042 4:21441839-21441861 ACAGAAGATCCCTAAATAAAAGG - Intronic
971310883 4:25524889-25524911 AAAGAAGCAACGCAAATAAAAGG - Intergenic
971596941 4:28541407-28541429 AAAGAAGAAAGCAAAAAAAATGG - Intergenic
971874951 4:32296630-32296652 AAATAAGAATCCCGAAGAAATGG + Intergenic
971888775 4:32490162-32490184 GCAAAAGAAACACAAATAAAGGG - Intergenic
972006756 4:34119210-34119232 AAAATAGAAACCCAAAGAAGTGG - Intergenic
972884610 4:43470436-43470458 ACAGAAACAAGCTAAAGAAATGG + Intergenic
972885870 4:43486739-43486761 ACAGAATGAACCCAAATGAATGG - Intergenic
972916608 4:43888636-43888658 ACAGAATAAAGACAAACAAAAGG - Intergenic
972967280 4:44526099-44526121 ACTGAAGAAAGCACAAGAAAAGG - Intergenic
973361264 4:49166959-49166981 AAACAAGAAACCCAAAACAATGG - Intergenic
973653767 4:53024243-53024265 CCAGAAAAAATCCAAAGAAGTGG + Intronic
973722025 4:53733756-53733778 ACAGCAAGAACACAAAGAAATGG + Intronic
973943149 4:55930943-55930965 AGAGAAGAAACCTAAGAAAAAGG + Intergenic
975121394 4:70732302-70732324 TCTGAAGAACGCCAAAGAAAAGG - Intronic
975129535 4:70818792-70818814 ACACAAGGAACCCAAACAGAAGG + Exonic
975272942 4:72459180-72459202 ACAAAAGAAGCCCAAAGTTAGGG + Intronic
975910090 4:79257469-79257491 AAAGAAGAAAACCAAAGCAAAGG - Intronic
976153604 4:82118474-82118496 ACAGAAGTAACTCAAAGGAAGGG + Intergenic
976306697 4:83566808-83566830 ACAAAAGAAAACCTAACAAATGG - Intronic
976651822 4:87443718-87443740 ACAGCAGGAAGCCTAAGAAAAGG + Intronic
976718381 4:88146995-88147017 AAAGAAGAAAGAGAAAGAAAAGG + Intronic
976799287 4:88970805-88970827 AAAAAATAAACCCAAAGAGAGGG + Intronic
976864056 4:89703022-89703044 ACAGAGATAACCAAAAGAAAAGG - Intergenic
977209458 4:94202142-94202164 ACAGAAGAAAACCAAAGCAAAGG - Intergenic
977447995 4:97155898-97155920 ACAGACTAAACTCAAAGTAATGG + Intergenic
977962839 4:103104850-103104872 ACAAAAGTAACCCAAAGTAGTGG - Intergenic
979229093 4:118326040-118326062 ACAGAAAAAGGCCAAATAAATGG + Intronic
979736488 4:124092153-124092175 AGAGAAAAACCCCAAAGAAATGG + Intergenic
979861149 4:125695656-125695678 TCAGAATAAACCCAATAAAAAGG + Intergenic
979944481 4:126811325-126811347 ACAGTAGAAACTGAAATAAATGG + Intergenic
980242617 4:130196790-130196812 ATAAAAGAAGACCAAAGAAATGG + Intergenic
980766071 4:137306390-137306412 ACAGAAGAAAGTCAAAATAAAGG + Intergenic
980899887 4:138894914-138894936 ACAGCACAAATCCAAAGAATGGG + Intergenic
981026962 4:140086362-140086384 ACAAAAGAAAATGAAAGAAATGG - Intronic
981185964 4:141803719-141803741 ACAGAAGAGACACAAAGTATAGG + Intergenic
981891785 4:149746881-149746903 GGAGAAGAAAACCAAAAAAAAGG + Intergenic
982517977 4:156376077-156376099 AAAGACAAAACCTAAAGAAATGG + Intergenic
982659928 4:158194353-158194375 ACAGAATAAATTCAAAGAGATGG + Intergenic
982666958 4:158277184-158277206 ACTGAAGAAATCCAAAGGCATGG - Intergenic
982727323 4:158919440-158919462 ACATAAGAAACCCAAATTGAGGG - Intronic
982902187 4:161021059-161021081 AAAGAAGAAATGAAAAGAAATGG + Intergenic
983258931 4:165433912-165433934 ACGAAAGAAAGCCAAAGAACAGG - Intronic
983330972 4:166329009-166329031 ACTGAAGAAAGAAAAAGAAAGGG + Intergenic
983331918 4:166340665-166340687 ACAGTAGAAACTCAGGGAAATGG + Intergenic
984154531 4:176178455-176178477 AGAAAAGAAACCTTAAGAAAAGG - Intronic
984594957 4:181656280-181656302 ACAGAAGCCAGCCAAAGAAAGGG + Intergenic
984631978 4:182070640-182070662 ACAGAAGAAAAACATAGAATGGG + Intergenic
985315793 4:188657687-188657709 ACAGCAAAACCCCAAATAAACGG - Intergenic
985434648 4:189917086-189917108 CCAGAAGACACCCAAAGGTAAGG - Intergenic
986170776 5:5312758-5312780 TCAGAAGAAAACAAAAGGAAGGG - Intronic
986741756 5:10710993-10711015 ACAGAAGAGACAAAGAGAAAAGG + Intronic
986977945 5:13414326-13414348 GCACAAGAAGCTCAAAGAAATGG + Intergenic
987344345 5:16965715-16965737 ACAGAGAAAACAAAAAGAAATGG + Intergenic
987430983 5:17832842-17832864 ACAGAAGTAGAACAAAGAAATGG - Intergenic
987473486 5:18361535-18361557 ACAGAAGAAAACTGAAGCAATGG - Intergenic
988394756 5:30682557-30682579 ACAGATGAAAACCAAAGAATGGG + Intergenic
988414360 5:30927481-30927503 AGAGAAGAAACTCACAGAACAGG + Intergenic
988441141 5:31234621-31234643 ACAGAAGAGAAGCAAAGAAGTGG - Intronic
988620780 5:32821369-32821391 GCAGTAGAAATGCAAAGAAAAGG + Intergenic
988630352 5:32923641-32923663 ACAGAAGAGACCCATATGAAGGG + Intergenic
988664522 5:33310873-33310895 GCAGAAGACACAAAAAGAAAAGG + Intergenic
988921465 5:35946451-35946473 AGAGCAGAATCCCAAAGAGAAGG + Intergenic
988946454 5:36206424-36206446 GCAGTAGAAACCCAAAAAAGTGG + Intronic
989320877 5:40132363-40132385 AAAGGAGAAACGTAAAGAAATGG - Intergenic
989418977 5:41213245-41213267 AAAAAAGAAAGACAAAGAAATGG + Intronic
989692518 5:44160953-44160975 ACAGATGGAAGCAAAAGAAATGG + Intergenic
990220254 5:53580807-53580829 AAAGAAGAAAAGAAAAGAAAGGG - Intronic
990221171 5:53590250-53590272 ACAGACAAAACACAAGGAAAAGG - Intronic
990228022 5:53678472-53678494 ACAGAAGAAGATCAAAGCAATGG - Intronic
991009630 5:61869709-61869731 CCAAAAGAAACCAATAGAAATGG - Intergenic
991241361 5:64464636-64464658 AAAAAAAAAACCCAAATAAATGG + Intergenic
991498834 5:67255562-67255584 ACAAAAGAAACCCCAACTAAGGG - Intergenic
992067846 5:73123709-73123731 AGAACAGAAACCCAAAGATAAGG - Exonic
992402734 5:76426585-76426607 TCATAAGAAATGCAAAGAAAAGG - Intronic
992521119 5:77552594-77552616 AGAGAAGAAAGACAAAGAAATGG + Intronic
992680274 5:79145934-79145956 AAAGAAGCAAGACAAAGAAAGGG + Intronic
993242742 5:85412005-85412027 ACAGAGGAGACACAAACAAATGG - Intergenic
993355518 5:86902366-86902388 ATAGAAGAAAGCCAAAAATAGGG - Intergenic
993447690 5:88034298-88034320 CTATAAGAAACCCAAAGAACTGG - Intergenic
993498150 5:88631709-88631731 ACAAAGGAAAACCAATGAAATGG - Intergenic
993521854 5:88912517-88912539 ACAAAAAAAATGCAAAGAAATGG - Intergenic
993529605 5:89007788-89007810 ACAAAAGAAAACAAATGAAAAGG - Intergenic
993634745 5:90330522-90330544 AAAGAAAAAACCCAAACAAGTGG - Intergenic
993825551 5:92681574-92681596 ACAGATGAAACCAAATGTAAGGG - Intergenic
994407904 5:99368672-99368694 ACAGGAGAAAACCAGAGAACAGG + Intergenic
994446658 5:99883168-99883190 ACACAAGATACCCAATCAAACGG + Intergenic
994842318 5:104941379-104941401 AAAGAAGAAAGAGAAAGAAAGGG + Intergenic
994945784 5:106387343-106387365 AAAGAAGAAATGCAAAGAAAGGG + Intergenic
995368553 5:111391642-111391664 AAAGAAGAAAACCAAGGCAATGG + Intronic
995617093 5:113977098-113977120 AAAGCAGAAACACATAGAAATGG - Intergenic
995624947 5:114066242-114066264 ACAAAAGAAAGACAAAGAGATGG - Intergenic
996104381 5:119481947-119481969 ACTGCAGAAAACCAAAGATAAGG - Intronic
997077619 5:130698867-130698889 ACAGAATAAACACAACAAAAGGG + Intergenic
997303081 5:132820500-132820522 TCAGAAGAATCCCAAAAATAAGG - Intergenic
997316792 5:132943247-132943269 ACAGAAGAGATACAAGGAAATGG + Intronic
997360982 5:133294723-133294745 ACAGAATAAACCAGAAGAGATGG - Intronic
997384709 5:133463524-133463546 AGAGAAGAAACACAAAGCACAGG - Intronic
997666609 5:135634536-135634558 ACAAGACAAACCCAAAGAGAAGG + Intergenic
998028730 5:138844635-138844657 AAAAAAGAACACCAAAGAAAAGG - Intronic
998405384 5:141871372-141871394 ACAGAAGCAACCAAACAAAATGG - Intronic
998433422 5:142086015-142086037 ACAAAAAAACCCCAAAGAATTGG + Intergenic
999529199 5:152443573-152443595 TCAGAAGAAAACTATAGAAAGGG + Intergenic
999816011 5:155177212-155177234 ACAGAAAAAAGAAAAAGAAAAGG + Intergenic
1000185740 5:158856125-158856147 GCAGAAGAACCCCAGAGACAGGG - Intronic
1000755385 5:165152523-165152545 AAAGAAGAAACCAAAGCAAAAGG + Intergenic
1000927073 5:167207039-167207061 AAAAAAAAAACCCAAGGAAATGG + Intergenic
1001571065 5:172730986-172731008 AAATAAGTAAGCCAAAGAAAAGG - Intergenic
1001625001 5:173124786-173124808 ACAGAAGAAAAGCAAAGCAAGGG - Intronic
1002047038 5:176547791-176547813 AAAGAAGAAACCCAGATGAAGGG - Intronic
1002451313 5:179320305-179320327 TCAAAAAAAACCCAAAAAAATGG - Intronic
1002882084 6:1262092-1262114 ACAGAATAGACCCAAAGCACAGG - Intergenic
1002917061 6:1538041-1538063 ACAGACGAAGACCAAAGAAAAGG + Intergenic
1002988248 6:2212925-2212947 ACAGAAGAAATGATAAGAAAAGG - Intronic
1003365592 6:5471893-5471915 ACTGCTGAAACCCAAAGAAAGGG + Intronic
1003429110 6:6022714-6022736 ACAGAAGAGACACAAGGACAGGG + Intergenic
1003483277 6:6552772-6552794 ACAGAGGAAACAGAATGAAAGGG + Intergenic
1003559968 6:7172289-7172311 TCAGAAGATACCCAAAGAGGAGG + Intronic
1004098968 6:12588685-12588707 GCACAATAAACCCAAAGAAAGGG + Intergenic
1004117887 6:12789042-12789064 ACAAAAGAAGAACAAAGAAATGG - Intronic
1004246058 6:13977209-13977231 ACAGAGGAAACCCAAAGTGCTGG + Exonic
1004817969 6:19333134-19333156 ACTTAAGAAACCCAAAAAAGTGG + Intergenic
1005122487 6:22404879-22404901 GCAGAAGAATCCCAAGGACAGGG - Intergenic
1005873407 6:29994299-29994321 GCAGAAGAGACCCCAACAAAGGG - Intergenic
1006003911 6:30987721-30987743 GCAGCAGAAACACAAGGAAATGG + Intronic
1006377850 6:33681633-33681655 ACAAAAGAAACCCACAAAAGGGG + Intronic
1008048798 6:46878954-46878976 ACAGGAGAAAGCCGAAGAGAGGG + Intronic
1008351988 6:50502392-50502414 ACACAAGAAACCAAAAGCAAAGG + Intergenic
1008473395 6:51909609-51909631 ACAGAGGAGAATCAAAGAAAAGG - Intronic
1009050564 6:58270699-58270721 GCAGAATAAAAACAAAGAAATGG - Intergenic
1009239854 6:61171684-61171706 GCAGAATAAAAACAAAGAAATGG + Intergenic
1009484308 6:64200521-64200543 AAAGAAAACACCAAAAGAAAGGG + Intronic
1009572505 6:65405382-65405404 ACACAAGAAAAAAAAAGAAAAGG + Intronic
1009879362 6:69546119-69546141 AAAGAAGAAACCCAAAACATTGG - Intergenic
1010951652 6:82043955-82043977 ACAGAAAAAATTTAAAGAAATGG + Intergenic
1010991940 6:82489544-82489566 TCAGAAGAAACAAAAAGAGATGG + Intergenic
1011294305 6:85809843-85809865 AAAGAAGACAGCCAAAAAAAGGG - Intergenic
1011674284 6:89716327-89716349 ACTGAAGAAACCCTAACAAAAGG + Intronic
1011724137 6:90191125-90191147 ACAGAAGCAAACACAAGAAAAGG - Intronic
1011816722 6:91200037-91200059 ACAGAAGAGAACCAAAGGGATGG + Intergenic
1011891164 6:92161993-92162015 AAAGAAGAAAGAGAAAGAAAAGG + Intergenic
1012672517 6:102073236-102073258 AAAGAAAAGACCCAAAGATAGGG - Intergenic
1012735734 6:102940440-102940462 AAAGTAGAAACCAAAAGCAAGGG - Intergenic
1013368940 6:109454277-109454299 ACAGAAGAAATAAAAAGGAAGGG + Intronic
1013922294 6:115421212-115421234 ACAAAAAAAACCTAATGAAATGG - Intergenic
1014557385 6:122850914-122850936 ACAGAAGAAACCCAGAGCCAAGG - Intergenic
1014589086 6:123239848-123239870 ACAGAAAAACCTCAAATAAATGG + Intronic
1014743621 6:125173903-125173925 ACAGAAGAAAGCAAACTAAAGGG + Intronic
1015228168 6:130882663-130882685 ACAGAAGTAGCCCAAAGATGAGG + Intronic
1015596886 6:134874698-134874720 ACAAAAAAAAAACAAAGAAAAGG - Intergenic
1015602008 6:134919701-134919723 AAAGAAGTAAACCAAAGACAGGG + Intronic
1016168846 6:140982789-140982811 ACAGAATAATACCAAAAAAATGG + Intergenic
1016526528 6:145007479-145007501 ACAAAAAAAACACAAAAAAACGG - Intergenic
1016562742 6:145415199-145415221 ACAGAACACATCAAAAGAAATGG + Intergenic
1016950923 6:149578693-149578715 GATGAAGAAAGCCAAAGAAATGG + Intronic
1017153869 6:151305634-151305656 AAAGAAGAAATACAGAGAAAAGG - Intronic
1018084003 6:160286441-160286463 AAAGAAGAATCCCACTGAAAAGG - Intergenic
1018640358 6:165898927-165898949 TGAGAAGAGACCCAAAGAAATGG - Intronic
1020641947 7:10766398-10766420 ATAAAAGAAACCAAAAGACATGG + Intergenic
1020749805 7:12126081-12126103 ACAGAAGAAAATGACAGAAATGG + Intergenic
1020766776 7:12331889-12331911 AGACAAGAAACACAGAGAAAGGG - Intronic
1021773176 7:24025429-24025451 ACTGAAGAAGCCCACAGGAATGG + Intergenic
1021796745 7:24263252-24263274 AAATAAGAAGCCCAAAGATAGGG - Intergenic
1022357434 7:29629440-29629462 ACAAAAGAAAAGAAAAGAAAAGG + Intergenic
1022650385 7:32268455-32268477 ACACAAGAAAGACAAAGTAAGGG + Intronic
1022677290 7:32511813-32511835 CCAGAAGGAACAGAAAGAAATGG + Intronic
1022782727 7:33602418-33602440 ACAGGAGGCATCCAAAGAAAGGG + Intronic
1024047030 7:45591905-45591927 ACAGATGAGACACAAAGAAGGGG - Intronic
1024252534 7:47517336-47517358 ACAAAAGAAACCTAGAGGAAAGG + Intronic
1024375128 7:48628704-48628726 ACAGAAGTAAACAGAAGAAAAGG - Intronic
1024477217 7:49825920-49825942 AAGTAAGAAAGCCAAAGAAAGGG - Intronic
1024585319 7:50836858-50836880 ACAGAAGGAACCCACAGATGGGG + Intergenic
1024751649 7:52472894-52472916 ACAGAAGAAACCAACATATATGG - Intergenic
1026250885 7:68669699-68669721 AAAGCAGTAACCCAAAGGAAAGG + Intergenic
1027845644 7:83370549-83370571 AAAGAAGAAACAGAAAAAAAGGG - Intronic
1028492528 7:91428166-91428188 GCAAAGGAAACTCAAAGAAATGG + Intergenic
1028620988 7:92829242-92829264 AAACAAAAAACCCAAAGAAAAGG - Intronic
1028742597 7:94292920-94292942 AAAGATAAAGCCCAAAGAAAAGG - Intergenic
1028878567 7:95852262-95852284 ATAGAATAACCCAAAAGAAATGG - Intronic
1030227143 7:107166055-107166077 ACAGAAGAAAAACAAAAAACCGG - Intergenic
1030247679 7:107402635-107402657 ACAGAAGTCACACAAAGAAAGGG - Intronic
1030448587 7:109679971-109679993 ACAGAACACACAGAAAGAAAAGG - Intergenic
1030727397 7:112941152-112941174 ACAGATCAAACACAAAGACAAGG + Intergenic
1030801186 7:113854614-113854636 AAAGAGGAAACCCACACAAATGG + Intergenic
1030889244 7:114978397-114978419 ATAGAAAAAACCCAAATAAGTGG - Intronic
1030981510 7:116190369-116190391 ACAGAAGATTCACAAGGAAATGG + Intergenic
1031475535 7:122216686-122216708 AGAGAAGAAAGCCAAAGGACAGG + Intergenic
1031789030 7:126075930-126075952 AAACAAGAAAACCAAAGAGAAGG - Intergenic
1032183827 7:129706070-129706092 ACAGAACAAAGGCAAAGAAGCGG + Intronic
1032371715 7:131361060-131361082 ACTGCAGAAAACCAAAGACAAGG - Intronic
1032377801 7:131440741-131440763 AAAGAAGAAAGCCAAAACAATGG + Intronic
1032392166 7:131562404-131562426 AGAGAAGGGACCCATAGAAACGG + Intergenic
1032583703 7:133127703-133127725 AAAGAATAAAACCAAAGAGATGG - Intergenic
1033001468 7:137509780-137509802 ACAGAAGAAAGAGAATGAAAGGG + Intronic
1033338322 7:140472117-140472139 ACGAAATAAACACAAAGAAAGGG + Intronic
1033444732 7:141410401-141410423 ACAGAAGAAAAGAAAAGAAAAGG - Intronic
1033451561 7:141466594-141466616 ACAGAGGATACTTAAAGAAATGG - Intronic
1033500491 7:141944225-141944247 ACAGAAGAAAGGAAAAGTAATGG + Intronic
1033966655 7:146983430-146983452 ACAGAACAAAACCAAACAAAAGG + Intronic
1034378907 7:150671920-150671942 GCAGAGGAAACACAAAGACATGG - Intergenic
1034433742 7:151053418-151053440 ACAGGAGAGCCCCAAAGATATGG - Intergenic
1034486238 7:151365264-151365286 ACACAAAAAACCCAAAGCAGAGG - Intronic
1034565763 7:151914172-151914194 GAAGAAGAAAACCAAAGCAAGGG - Intergenic
1034578333 7:152020928-152020950 AGAGAAGAAACACATTGAAAGGG + Intergenic
1034944753 7:155254627-155254649 AGAGGAGAAAACTAAAGAAAAGG - Intergenic
1035084235 7:156243420-156243442 AAAGAAAAAATCCAAACAAATGG - Intergenic
1035209466 7:157317151-157317173 ACAAAAGAAAACAAAACAAAAGG + Intergenic
1035446590 7:158947422-158947444 CCAGAAGAGGCCCAAAGAAAAGG - Intronic
1035840802 8:2810277-2810299 ACAGAATACACCAGAAGAAATGG - Intergenic
1035967629 8:4211281-4211303 AAAGAAAAGAACCAAAGAAAAGG - Intronic
1036718979 8:11154738-11154760 AGAGAAGGAACCAACAGAAAAGG - Intronic
1036735823 8:11315302-11315324 ACAGGAGAAATACAAAGAATGGG + Intronic
1037169292 8:15871914-15871936 ACAGAACATACCAAAAGTAATGG + Intergenic
1037925893 8:22844077-22844099 ACAGAAGAAACACCAAGATTCGG + Intronic
1038081973 8:24148683-24148705 ATAGAAGATACAAAAAGAAAAGG - Intergenic
1038454865 8:27666671-27666693 ACAGAAGAAAATAAAACAAAGGG - Intronic
1038577924 8:28721342-28721364 ACAGGAGAAAGCCAGAGAGAGGG - Intronic
1038799204 8:30733912-30733934 ACAGATGAAGCACAGAGAAAAGG + Intronic
1038885718 8:31660564-31660586 ACAGAAGTTACCCAAAGATAGGG - Intronic
1038923315 8:32110321-32110343 AGAGAAGAAAGTCAAAGGAAAGG + Intronic
1039092975 8:33852261-33852283 AAAGAAGAGACCCAAAGGACAGG + Intergenic
1039368416 8:36958562-36958584 AAAAAGGAAAGCCAAAGAAAGGG - Intergenic
1039495237 8:37975393-37975415 AAAGAAGAAAAGAAAAGAAAAGG + Intergenic
1039569149 8:38573188-38573210 ACAGAAGAAACAGAAGAAAATGG - Intergenic
1040374195 8:46807154-46807176 TCAGAAGAAACAAAAAGAGATGG - Intergenic
1040629738 8:49196695-49196717 TAAGAAGAAAACTAAAGAAAAGG - Intergenic
1041167479 8:55103411-55103433 TCAAAAGAAACCCAAAAAACTGG - Intronic
1041225515 8:55693522-55693544 ACAGCAGAAACCTAAAGATCAGG + Intergenic
1041280380 8:56204154-56204176 ACAGAAGATAGCTTAAGAAAAGG + Intronic
1041385969 8:57302919-57302941 ACAGAAGATAGCAAAATAAAGGG - Intergenic
1041416561 8:57616783-57616805 GCAACTGAAACCCAAAGAAAAGG - Intergenic
1041480672 8:58316492-58316514 AAAGCAGAAGCCAAAAGAAATGG - Intergenic
1041594752 8:59635781-59635803 TCAGAATAAAACCAAAGAATAGG + Intergenic
1041776742 8:61531105-61531127 ACAAAATAAAGCCAATGAAAAGG - Intronic
1042094700 8:65200888-65200910 AGAGAAGAAAGCTAAAGAATGGG - Intergenic
1042359770 8:67869365-67869387 AAAGAAGAAACACACAGAGAAGG + Intergenic
1042366398 8:67941642-67941664 AGAGAAGAGAAGCAAAGAAATGG - Intergenic
1042489962 8:69385907-69385929 TCAGAAGTAACACAAACAAATGG + Intergenic
1042717871 8:71794542-71794564 ACATAAGCAACTCACAGAAATGG - Intergenic
1042799060 8:72698014-72698036 ACACAAGAGAAACAAAGAAAGGG + Intronic
1042832568 8:73048153-73048175 ACAAAACAAAACCAAAAAAAAGG - Intergenic
1043206194 8:77444894-77444916 ACAGAAGAAAACAAAAGAGAGGG - Intergenic
1043559595 8:81476387-81476409 ACACAAGACATACAAAGAAATGG - Intergenic
1043794008 8:84512335-84512357 TCAAAAGAAAACCAAAAAAATGG - Intronic
1044037840 8:87327828-87327850 CTAGAAGAAAACCTAAGAAAAGG - Intronic
1044217228 8:89626070-89626092 ACAGATAACACCCTAAGAAAAGG + Intergenic
1044716516 8:95104729-95104751 ACAAAAGAAACACAGAGGAAAGG - Intronic
1044801678 8:95963648-95963670 ACAGAAGAAATTAAAAGAAAAGG - Intergenic
1045466007 8:102470437-102470459 ACATAAGAAACCCAGAGAGATGG + Intergenic
1046084343 8:109413614-109413636 AAACAAAAAACCCCAAGAAATGG - Intronic
1046723094 8:117643581-117643603 AAAAAAGAAACCTAAAGAATAGG + Intergenic
1047417540 8:124677436-124677458 ACAGACAAAACCCAAATGAATGG + Intronic
1047773163 8:128046882-128046904 CCTGGAGAAAACCAAAGAAAGGG - Intergenic
1048933305 8:139334785-139334807 ACAGAGAAAACCAAAACAAAGGG - Intergenic
1049060734 8:140274220-140274242 AAAAAAAAAACCCACAGAAAAGG + Intronic
1049062512 8:140286971-140286993 ACAAAAGAGACCCAAACAGAAGG + Intronic
1049143590 8:140980652-140980674 ACAGACAAAACACGAAGAAATGG + Intronic
1049271147 8:141696943-141696965 AAAGATGAAACCCAAGGAATGGG - Intergenic
1049883562 9:13768-13790 ACAGGGGAACCCCGAAGAAATGG + Intergenic
1050057779 9:1673759-1673781 AAAGAAGAAAAGAAAAGAAAAGG - Intergenic
1050235292 9:3571757-3571779 GCAGAAGAAATAAAAAGAAAAGG + Intergenic
1050361372 9:4834275-4834297 AAAAAAGAAATCCAAATAAATGG - Intronic
1050443639 9:5694196-5694218 GCAGAAGAAACCTACAGTAAGGG + Intronic
1050865415 9:10491532-10491554 ACAAAAAAAACCCATTGAAATGG + Intronic
1051078691 9:13271559-13271581 AAAGAAGAGACCCAAAGAAGAGG - Intronic
1051094671 9:13452886-13452908 ATAGAGGAACCCCAAATAAAGGG + Intergenic
1051468662 9:17409402-17409424 ACAGAAGACAGCCAAACACAAGG + Exonic
1051531815 9:18112474-18112496 AAAAAAAAAACCCAAAAAAATGG - Intergenic
1051552003 9:18340156-18340178 ACAGAATAAAGCTAAAGAATAGG - Intergenic
1052841493 9:33295107-33295129 AGAGAAGATACCCACAGAAAAGG + Exonic
1053492356 9:38518460-38518482 AGACAGGAAACCCAAATAAATGG + Intergenic
1053593458 9:39534918-39534940 AGAGAAGAATCCCAATGAGAAGG + Intergenic
1053812868 9:41872648-41872670 AGAAAAGAAAACAAAAGAAAAGG + Intergenic
1054572848 9:66830359-66830381 AGAGAAGAATCCCAATGAGAAGG - Intergenic
1054617727 9:67314791-67314813 AGAAAAGAAAACAAAAGAAAAGG - Intergenic
1054716692 9:68563935-68563957 AAAAAAAAAACCCAAAAAAATGG + Intergenic
1054959689 9:70954116-70954138 GCAGAAGGAAACCAAAGAGAAGG + Intronic
1055304163 9:74911233-74911255 ACAAAAGGAACTCAAAGTAATGG + Intergenic
1055326176 9:75132353-75132375 ACAGAATAAAGCCCAAGACAAGG - Intronic
1055379090 9:75686718-75686740 CCAGAACAAATCCAGAGAAAGGG - Intergenic
1055430582 9:76239346-76239368 TCTGAGGAAACCCAGAGAAAGGG - Intronic
1055562103 9:77531197-77531219 ATAGAAAGCACCCAAAGAAATGG + Intronic
1055650568 9:78403102-78403124 ACAGAAGAAAACAAAAGGACAGG - Intergenic
1056079709 9:83078986-83079008 ACAGAGGAAACCTACAGAATGGG - Intergenic
1056099867 9:83291025-83291047 AAAGAAGAAACAAAAAGACATGG + Intronic
1056434328 9:86560676-86560698 ACAGAAGAAAACAAAGTAAATGG + Intergenic
1057019479 9:91685487-91685509 AAAGAAGAAAAACAGAGAAAGGG + Intronic
1057259029 9:93574057-93574079 AAAGAAAAAACAAAAAGAAAGGG + Intergenic
1058344564 9:103945658-103945680 ACAGAAGAAAGATAAAGAAAAGG - Intergenic
1058589742 9:106550620-106550642 ACAAAAGAAACATAAAGAAGTGG + Intergenic
1059168830 9:112105094-112105116 CTAGATGAGACCCAAAGAAAAGG + Intronic
1059211890 9:112521016-112521038 ACAAAAGAAACAAGAAGAAAAGG - Intronic
1059532088 9:115044468-115044490 AGAGAAGAAAATCAAAGAGAGGG + Intronic
1059656581 9:116362993-116363015 ACAGAAGACTCCCACAGGAAGGG + Intronic
1059822141 9:117985056-117985078 AGAAATGAAACCCACAGAAAAGG + Intergenic
1059851094 9:118341071-118341093 AAAGAAGAAAAGAAAAGAAAAGG + Intergenic
1059866211 9:118517057-118517079 AGAGAAGTAACCGAAGGAAAAGG + Intergenic
1059932803 9:119278137-119278159 ACAGAAGAGTCCCAGAGAAGGGG - Intronic
1060378129 9:123137287-123137309 AAAGGAGAAACCAAAAGATAGGG + Intronic
1060688857 9:125638222-125638244 ACAGGACAAACCAAAAGAGAGGG + Intronic
1061117613 9:128624545-128624567 GCAGAAGAAAACCAATGACACGG - Intronic
1061379938 9:130248975-130248997 AGCAAAGAAACCTAAAGAAATGG - Intergenic
1061647938 9:132021451-132021473 ACAGAAGAAAGGGAAAAAAAGGG + Intronic
1203452909 Un_GL000219v1:137306-137328 ACAAAAGAACCCCAAAAGAATGG + Intergenic
1203711708 Un_KI270742v1:104235-104257 AAAGCAGAAACCCAAAACAATGG + Intergenic
1203555312 Un_KI270743v1:202509-202531 AAACAAGAAACCCAAAACAATGG + Intergenic
1185535543 X:858654-858676 AGAGAAGAAAACAAAAGGAAGGG + Intergenic
1185891665 X:3827635-3827657 ACTGACCAAACCTAAAGAAACGG + Intronic
1185896775 X:3866049-3866071 ACTGACCAAACCTAAAGAAACGG + Intergenic
1185901893 X:3904476-3904498 ACTGACCAAACCTAAAGAAACGG + Intergenic
1185930269 X:4195173-4195195 AGAGGAGAAAACAAAAGAAAAGG + Intergenic
1186115197 X:6297984-6298006 AAAGTAGAAACACAAAGGAAGGG + Intergenic
1186361409 X:8845721-8845743 ACAGCAGAACTCCAAAGGAATGG - Intergenic
1186491241 X:9974644-9974666 AAAGAAAAAACCCAAAAAACTGG - Intergenic
1186581280 X:10821787-10821809 AAGGAAGAAAACAAAAGAAAGGG - Intronic
1187065765 X:15836366-15836388 ACAGATGAAAGCAAAACAAATGG - Intronic
1187261783 X:17691466-17691488 TCAGAAGAATCCCAAGCAAAGGG + Intronic
1187428376 X:19199224-19199246 ACATAGCAAACCCAAAGAAGAGG - Intergenic
1187445335 X:19356017-19356039 ACAGAATTAACCTAAGGAAAAGG - Intronic
1187518716 X:19994985-19995007 TCACATGAAACCCAAAGGAAAGG - Intergenic
1187926392 X:24254314-24254336 AAAAAAGAAACCAAAAGAAACGG - Intergenic
1187978297 X:24727175-24727197 ACTGAAGAAACAAACAGAAAAGG - Intronic
1188005622 X:25013994-25014016 AAAGAAGGAACCCAGAGAAAGGG - Intronic
1188021298 X:25161621-25161643 AGAGAAGAAAACCAAAGCAATGG - Intergenic
1188135817 X:26493535-26493557 ATATAAGAATTCCAAAGAAATGG - Intergenic
1188316152 X:28676344-28676366 ACAGATTAAACACCAAGAAAAGG + Intronic
1189346245 X:40243574-40243596 CCAGAAGAGCCCCAGAGAAAAGG + Intergenic
1189499232 X:41539814-41539836 ACAGAAGAAACCTGAAGAGATGG + Intronic
1189600341 X:42617293-42617315 AGAGAAGAGAAGCAAAGAAAGGG - Intergenic
1189674131 X:43443724-43443746 AAAGAAGAAAAGAAAAGAAAAGG + Intergenic
1190008798 X:46764708-46764730 ACAGAGGGAACAAAAAGAAAAGG + Intergenic
1190427448 X:50346271-50346293 ACAGAAGGAAGCCACAGAAATGG - Intronic
1191849728 X:65577340-65577362 CCAGAAGAAACCTAATGAATGGG - Intergenic
1192414967 X:70971305-70971327 ATAGAAGAAAACCAAAGCAAGGG + Intergenic
1193855857 X:86600768-86600790 AAAGAGGACACCCAAAGAACTGG - Intronic
1195025008 X:100867849-100867871 AGAGAAGAAAGAGAAAGAAAAGG + Intronic
1195647128 X:107245232-107245254 ACAGAACAAAAACAGAGAAAAGG - Intergenic
1195780379 X:108456464-108456486 ACATACAAAATCCAAAGAAATGG - Intronic
1196339112 X:114575597-114575619 ACAAAAGAAAAACAAACAAAGGG + Intergenic
1196391585 X:115212477-115212499 ACAGAAACAAACCAAAGCAAAGG - Intronic
1196463534 X:115951852-115951874 ACAAAACAAACCCAAAAAACAGG + Intergenic
1196537516 X:116864944-116864966 TCAGAAGGAACACAAACAAAAGG - Intergenic
1196579029 X:117358163-117358185 ATTGAGGAAACACAAAGAAATGG - Intergenic
1196924702 X:120621953-120621975 TCAGTAGAAACCTAAAGAAATGG + Intergenic
1197041770 X:121944681-121944703 ACACAAAAAATCCAAAGACAGGG + Intergenic
1197127835 X:122968846-122968868 ACACAAAATACCTAAAGAAAAGG + Intergenic
1197262823 X:124334839-124334861 TCAGAGAAAGCCCAAAGAAATGG + Intronic
1197529741 X:127608632-127608654 TCAGTAGAAACACACAGAAAGGG - Intergenic
1197666233 X:129226881-129226903 ACTGAAGAAAACCAAAGACAAGG + Intergenic
1197793300 X:130276941-130276963 ACAGAAAAAATTCACAGAAATGG + Intergenic
1198087628 X:133295556-133295578 ACAGATTAGACCCAAAGAACAGG - Intergenic
1198163925 X:134034677-134034699 ACAGAACAAAACAAAACAAAAGG - Intergenic
1198506082 X:137302678-137302700 ACAACAGAAACCCCCAGAAAGGG - Intergenic
1199379900 X:147158174-147158196 ATAGAAGACACACAAAAAAATGG + Intergenic
1199486858 X:148357815-148357837 ACTGAAGTACCCCAAAGAAGAGG - Intergenic
1199570723 X:149264496-149264518 AAAGAAGAAAAGCAAAGAATGGG + Intergenic
1199919182 X:152379649-152379671 AAAAAATAAGCCCAAAGAAAAGG - Intronic
1200118542 X:153779912-153779934 ACAGAGGAGTCCCAATGAAAGGG - Intronic
1200167883 X:154049863-154049885 CCAGAAGAGACACAAGGAAAGGG + Intronic
1200402254 X:156026381-156026403 ACAGGGGAACCCCGAAGAAATGG - Intergenic
1200469534 Y:3566732-3566754 ACAGAAGTAACCAAGATAAATGG + Intergenic
1200617891 Y:5402462-5402484 ACTGAAGAAACCAAAATTAATGG + Intronic
1200981259 Y:9265156-9265178 AGACAAGCAACCAAAAGAAAAGG + Intergenic
1201313271 Y:12617008-12617030 ACAGAAGAAAACAAATTAAAGGG + Intergenic
1201481741 Y:14446977-14446999 AAAGTAGAAACGCAAACAAAGGG - Intergenic
1201634063 Y:16102543-16102565 AAAGAAGAAAATCAAAAAAATGG + Intergenic