ID: 1075601752

View in Genome Browser
Species Human (GRCh38)
Location 10:123774288-123774310
Sequence GTTCCACGCCACCCCGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075601752_1075601754 10 Left 1075601752 10:123774288-123774310 CCCACAGCGGGGTGGCGTGGAAC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1075601754 10:123774321-123774343 CTAGCAAGCTGCCAAAAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075601752 Original CRISPR GTTCCACGCCACCCCGCTGT GGG (reversed) Intronic
904199127 1:28807899-28807921 TTTCCCCACCACCCCGGTGTAGG - Intergenic
905676738 1:39831389-39831411 CTTCCCCGCCCCCCGGCTGTGGG - Intergenic
907509177 1:54945723-54945745 GCCCCACCCCACCCCTCTGTGGG - Intergenic
912375762 1:109208598-109208620 CTTCCACGTCACCCCACTGTGGG + Intergenic
916071798 1:161174600-161174622 GTTCCACACCACACCATTGTTGG - Intronic
921131704 1:212225203-212225225 CTTGCATGCCACCCAGCTGTGGG - Intergenic
1072536069 10:96364162-96364184 GTTCCAGGCCTCCCCACTGGGGG - Intergenic
1075601752 10:123774288-123774310 GTTCCACGCCACCCCGCTGTGGG - Intronic
1080845914 11:36026641-36026663 GTTCCTCGCCATCTCGCTTTTGG - Intronic
1091689342 12:2585045-2585067 GTTCCAGGCCACACAGCTGCCGG + Intronic
1096428108 12:51521192-51521214 GTGCCACGCCACCCTGCACTGGG + Intergenic
1101025399 12:100599111-100599133 ATTCCAAGCCACCCCACTCTTGG + Intronic
1102747373 12:115261122-115261144 GTACCACCCCACCCCACTCTTGG + Intergenic
1120914930 14:89702226-89702248 GCTCCACCCCAACCAGCTGTAGG - Intergenic
1122717869 14:103706227-103706249 GTTCCCAGCCACACCGCTGCTGG + Intronic
1122945576 14:105007121-105007143 CTTCCACTCCAGCTCGCTGTAGG + Intronic
1124629841 15:31329853-31329875 ACTCCCCGCCACCCCGCTGCCGG - Intronic
1131712729 15:95073528-95073550 GTTCCACCACAGCCCGCGGTAGG + Intergenic
1135700864 16:24631388-24631410 GTTCCAGGACACCCCACTCTTGG + Intergenic
1152928078 17:83096987-83097009 ATTCCCTGCCGCCCCGCTGTGGG - Intergenic
1153787014 18:8544204-8544226 GTGCCAGGCCAGCCCCCTGTGGG - Intergenic
1154999778 18:21674909-21674931 CCTCCACCCCACCCCACTGTGGG - Intronic
1164746832 19:30622684-30622706 GTTCCCCGCTACGCAGCTGTAGG + Intronic
1168714766 19:58520243-58520265 GCTCCAGGCCCGCCCGCTGTGGG + Intronic
928947955 2:36789156-36789178 TTTCCACTCCACCCTGCTGCTGG - Intronic
944482823 2:200175011-200175033 CTCCCCCGCCAACCCGCTGTGGG + Intergenic
1168932742 20:1636950-1636972 GTTCCAGGCCACCCCTCTCATGG - Intronic
1173598916 20:44279147-44279169 CATCCACACCACCCTGCTGTCGG + Exonic
1175976717 20:62714179-62714201 GACCCACGCCACGCAGCTGTGGG + Intronic
1180834639 22:18923764-18923786 GTTTCACGCCACCCCAATGCAGG + Intronic
1203284728 22_KI270734v1_random:149063-149085 GTTTCACGCCACCCCAATGCAGG + Intergenic
950363724 3:12468441-12468463 GCTCCAGGCCACCCAGCTGTAGG + Intergenic
960456044 3:117873452-117873474 GCTCCACACCACCCTGCTGCAGG + Intergenic
960938070 3:122915487-122915509 ATTCCCCTCGACCCCGCTGTGGG - Exonic
967688822 3:192449461-192449483 GTTCCACAGCACCCTGCTGTCGG + Intronic
971096378 4:23409289-23409311 GTTCCAGGCCTCCAGGCTGTGGG + Intergenic
978524503 4:109651965-109651987 CTTCCTCGCCACCCTTCTGTAGG + Intronic
985494113 5:194990-195012 GTTCCTCGGGAACCCGCTGTCGG + Exonic
1002826058 6:775489-775511 GATCCAGGCCACCTCGCGGTCGG + Intergenic
1002855666 6:1035814-1035836 GTGCCAGGCCTCCCGGCTGTAGG + Intergenic
1010510511 6:76712782-76712804 GTTCCATTCCATACCGCTGTTGG - Intergenic
1018212641 6:161496988-161497010 GTTCTACGCCACCCGGCTTGTGG + Intronic
1018547253 6:164951238-164951260 GTTCCACGCCAAAGAGCTGTGGG - Intergenic
1019538254 7:1539862-1539884 GTTCCTGGCCACCCCAGTGTCGG + Intronic
1021340594 7:19458459-19458481 GGTCCCTGCCACCCTGCTGTGGG - Intergenic
1023820307 7:43977084-43977106 GGTCCCAGCCACCCTGCTGTGGG - Intergenic
1027237990 7:76309566-76309588 GAGCCTCCCCACCCCGCTGTGGG - Intergenic
1029748592 7:102530605-102530627 GGTCCCAGCCACCCTGCTGTGGG - Intergenic
1029766539 7:102629689-102629711 GGTCCCAGCCACCCTGCTGTGGG - Intronic
1035986516 8:4438482-4438504 GTTCCACAGCACCTGGCTGTAGG + Intronic
1044941003 8:97343687-97343709 GTTACACACCACCTGGCTGTGGG - Intergenic
1049357787 8:142197176-142197198 GCTCCCAGCCACCCCGCTGCTGG + Intergenic
1049745663 8:144262208-144262230 CTTCCACCCCACCCAGCCGTGGG - Exonic
1056717960 9:89048835-89048857 GATCCCCGTCACCCCGCTCTCGG + Intronic
1058013020 9:99999090-99999112 TGTCCACGCCCCGCCGCTGTGGG - Intronic
1058793616 9:108475224-108475246 TTTCCACACCACCCTGCTGTGGG + Intergenic
1060657267 9:125380644-125380666 ATTTCAAGCCACCCCGCTCTGGG - Intergenic
1061006425 9:127930786-127930808 ATTCCCCGCCGCCCCGCTGCAGG + Exonic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic