ID: 1075602633

View in Genome Browser
Species Human (GRCh38)
Location 10:123781590-123781612
Sequence GAGTGGCCCTAGGAGCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 119}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075602633_1075602642 -1 Left 1075602633 10:123781590-123781612 CCCAGTGGCTCCTAGGGCCACTC 0: 1
1: 0
2: 4
3: 12
4: 119
Right 1075602642 10:123781612-123781634 CTAGAGGCAGTGGGGGCAGTAGG No data
1075602633_1075602639 -9 Left 1075602633 10:123781590-123781612 CCCAGTGGCTCCTAGGGCCACTC 0: 1
1: 0
2: 4
3: 12
4: 119
Right 1075602639 10:123781604-123781626 GGGCCACTCTAGAGGCAGTGGGG No data
1075602633_1075602645 2 Left 1075602633 10:123781590-123781612 CCCAGTGGCTCCTAGGGCCACTC 0: 1
1: 0
2: 4
3: 12
4: 119
Right 1075602645 10:123781615-123781637 GAGGCAGTGGGGGCAGTAGGGGG No data
1075602633_1075602646 24 Left 1075602633 10:123781590-123781612 CCCAGTGGCTCCTAGGGCCACTC 0: 1
1: 0
2: 4
3: 12
4: 119
Right 1075602646 10:123781637-123781659 GCCGAACACTCTGTGTTATGTGG No data
1075602633_1075602644 1 Left 1075602633 10:123781590-123781612 CCCAGTGGCTCCTAGGGCCACTC 0: 1
1: 0
2: 4
3: 12
4: 119
Right 1075602644 10:123781614-123781636 AGAGGCAGTGGGGGCAGTAGGGG No data
1075602633_1075602643 0 Left 1075602633 10:123781590-123781612 CCCAGTGGCTCCTAGGGCCACTC 0: 1
1: 0
2: 4
3: 12
4: 119
Right 1075602643 10:123781613-123781635 TAGAGGCAGTGGGGGCAGTAGGG No data
1075602633_1075602640 -8 Left 1075602633 10:123781590-123781612 CCCAGTGGCTCCTAGGGCCACTC 0: 1
1: 0
2: 4
3: 12
4: 119
Right 1075602640 10:123781605-123781627 GGCCACTCTAGAGGCAGTGGGGG No data
1075602633_1075602638 -10 Left 1075602633 10:123781590-123781612 CCCAGTGGCTCCTAGGGCCACTC 0: 1
1: 0
2: 4
3: 12
4: 119
Right 1075602638 10:123781603-123781625 AGGGCCACTCTAGAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075602633 Original CRISPR GAGTGGCCCTAGGAGCCACT GGG (reversed) Intronic
900250967 1:1669506-1669528 GAGTTGCCCTGGGAGCCACTCGG - Intronic
901188047 1:7387571-7387593 GAGAGGCCCCAGGAGGCACCTGG - Intronic
902482437 1:16718885-16718907 GGGTGGCCCTAGGACCCACCAGG - Intergenic
902501016 1:16911955-16911977 GAGTGGTCCTGGGGGTCACTGGG + Intronic
903818027 1:26079391-26079413 GTGAGGCCCTACGTGCCACTGGG + Intergenic
904355090 1:29933649-29933671 GGGTGGCCCTGGGAGTCCCTGGG + Intergenic
911164278 1:94711357-94711379 GCCAGGCCCTATGAGCCACTAGG + Intergenic
914995104 1:152536504-152536526 GAGTGGTCCTGGTAGCAACTGGG + Intronic
1070648157 10:78215736-78215758 GAGAGGCTCCAAGAGCCACTGGG - Intergenic
1075247202 10:120833214-120833236 AAGTGTCCCTAGGAGGCACTGGG + Intergenic
1075602633 10:123781590-123781612 GAGTGGCCCTAGGAGCCACTGGG - Intronic
1075649680 10:124119365-124119387 GCCTGGCCCTAGGAGCCTCATGG + Intergenic
1075811276 10:125226879-125226901 GCATGGCCCCAGGACCCACTGGG - Intergenic
1077155707 11:1089980-1090002 GAGTGGCACTATGAGCCATGTGG + Intergenic
1077402888 11:2367779-2367801 CAGTGGCCCCAGAAGCCTCTGGG + Intergenic
1078424858 11:11240911-11240933 GAGTGGGCCTAGGAGTCAGGAGG - Intergenic
1080644807 11:34180809-34180831 GAGGGGCCTTAGGAGACCCTTGG - Intronic
1083325592 11:61871446-61871468 GCGTGGCACTAGGAGCCAACAGG + Intergenic
1084042437 11:66550051-66550073 AGGTGGCCCTGGGAGCCATTTGG - Intronic
1084083654 11:66844792-66844814 GAGGAGCCCTTGGAGCCTCTGGG + Intronic
1084368051 11:68716571-68716593 GTGTGGCCCCAGGAGTCACAGGG - Intronic
1085333359 11:75670573-75670595 GAGTGTCCTAAGAAGCCACTTGG + Intergenic
1088911898 11:114198512-114198534 GAGGGGCCCTGGGAGCCACTAGG - Intronic
1091640524 12:2233609-2233631 TAATGGCCCCAGGAGCTACTGGG - Intronic
1094424200 12:30301863-30301885 GAGTGGCCATAGTGGCCCCTGGG + Intergenic
1100692955 12:97058454-97058476 GGGTGGCCCTAGGATCCACTGGG - Intergenic
1102996915 12:117358476-117358498 GAGTGTCCCATGGAGCCATTTGG - Intronic
1103918399 12:124387596-124387618 CCGTGGCCCTGGGAGCCACGTGG + Intronic
1104077805 12:125405888-125405910 GAGTGGCGCTAGGATGCACATGG + Intronic
1104256677 12:127145917-127145939 GCGTGGCCATAGGAGCATCTGGG - Intergenic
1105656969 13:22452206-22452228 GAGTGGCCCTGGGAGCAATCTGG + Intergenic
1106134754 13:26965774-26965796 GAATGGGCCTTGCAGCCACTGGG + Intergenic
1106833914 13:33613733-33613755 CAGTGGACGTGGGAGCCACTCGG + Intergenic
1114404730 14:22445776-22445798 GAGTGGCCCTAGGATAGTCTGGG + Intergenic
1115471887 14:33776447-33776469 GAGTGGCACCATGAGGCACTCGG - Intronic
1116814495 14:49570824-49570846 GAGTGGTCTTAGGAACCCCTGGG + Intergenic
1119030957 14:71192434-71192456 GGAAGGCCCTGGGAGCCACTGGG + Intergenic
1120602263 14:86525967-86525989 GAATGGCCCAGGGAGCCACGTGG + Intergenic
1122441905 14:101737621-101737643 GAGGGGCCCCAGGAGACAGTGGG + Intergenic
1123067057 14:105624104-105624126 GAGAAGCCCTAGGAGCCCCTGGG - Intergenic
1123071079 14:105642831-105642853 GGGAAGCCCTAGGAGCCCCTGGG - Intergenic
1123076041 14:105667873-105667895 GAGAAGCCCTAGGAGCCCCTGGG - Intergenic
1123090741 14:105741101-105741123 GAGAAGCCCTAGGAGCCCCTGGG - Intergenic
1123096374 14:105768865-105768887 GGGAAGCCCTAGGAGCCCCTGGG - Intergenic
1127554421 15:60073438-60073460 AAGTGGTTCTAGAAGCCACTTGG + Intergenic
1129334379 15:74843477-74843499 GAGGGGCCCTGGGAGCCTCCCGG - Intergenic
1133959957 16:10484794-10484816 GAGTGGCCCAAGGAATCACTAGG + Intergenic
1134038475 16:11049955-11049977 CAGAGGGCCAAGGAGCCACTTGG - Intronic
1136411225 16:30078480-30078502 GAGTGGAACTAGGAGGTACTAGG + Intronic
1138662164 16:58527737-58527759 GATTGGTTCTAGGACCCACTGGG - Intronic
1142526845 17:548745-548767 GAGTAGCCTGAGGAGCCCCTGGG + Intronic
1142808387 17:2383633-2383655 GACTGGCCCCAGGTGCCACAAGG + Intergenic
1145269724 17:21398340-21398362 CAGTGGCCAGAGGAGGCACTGGG - Intronic
1146635256 17:34499380-34499402 GAGTTAGCCTAGGAGACACTAGG + Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1152420716 17:80191547-80191569 GGGTGGCCCATGGAGGCACTGGG + Intronic
1157953717 18:52070390-52070412 GAGTGGCCTTTGCACCCACTGGG - Intergenic
1158450302 18:57558050-57558072 GCTTGGCCCTAGTAGCCACCAGG + Intronic
1158923253 18:62218738-62218760 GAGTTGGACTATGAGCCACTTGG + Intronic
1160776482 19:858913-858935 GAGGGGCCCACTGAGCCACTGGG + Intergenic
1162021549 19:7870507-7870529 GCGTGGCCGAAGGAGACACTGGG + Exonic
1163953323 19:20611710-20611732 CTGTGGCCCCAGGTGCCACTGGG + Intronic
1165150756 19:33758891-33758913 GTGTGGCCCCAGCATCCACTTGG + Intronic
1166205027 19:41264213-41264235 GAGAAGGCCTAGGAGCTACTGGG - Intronic
927438481 2:23090722-23090744 GAGTGGGCTGAGGAGCCACGAGG - Intergenic
931474165 2:62570973-62570995 GAGCAGCCCTAGAAGCCCCTTGG + Intergenic
934066757 2:88348551-88348573 GCATGGCCACAGGAGCCACTAGG - Intergenic
935582494 2:104769119-104769141 AATTGGACCTAGGAGACACTTGG - Intergenic
1172481707 20:35275410-35275432 GAGTGGCCTTAGCAGCACCTTGG - Exonic
1172512008 20:35507369-35507391 GAGTGGCTATATGGGCCACTGGG + Intronic
1172705273 20:36878132-36878154 GAGTGACTCTAGGTGCCCCTGGG - Intronic
1172809082 20:37634177-37634199 CAGTGCCCCTAGGATCCACCTGG + Intergenic
1173664210 20:44753536-44753558 GGCTGGCACTAGGGGCCACTGGG - Intronic
1174294698 20:49537270-49537292 CAGGGGCCGTAGGAACCACTGGG - Intronic
1175218835 20:57405516-57405538 GTGTGGCCACAGCAGCCACTAGG + Intronic
1175516128 20:59571427-59571449 AAGTGGCCCTTGAAGCCCCTGGG + Intergenic
1175784640 20:61704880-61704902 ATTTGGCCCTAGGAGACACTTGG - Intronic
1176105436 20:63383739-63383761 GATAGGGCCTAGGAGTCACTGGG + Intergenic
1180065265 21:45409121-45409143 GACTGGCCCTGGCAGGCACTGGG - Intronic
1181048879 22:20229392-20229414 GAGTGGGTCTGGGTGCCACTGGG + Intergenic
1181311384 22:21946662-21946684 GGGTGGCCCCAGCAGCCTCTGGG - Intronic
1181474606 22:23160617-23160639 GAGTGGCCCAAGCAGGCAGTGGG + Intronic
1182609957 22:31539207-31539229 GAGGGGCCATTGGAGTCACTCGG - Intronic
1183714231 22:39524373-39524395 AAGTGGCCCGAGGCACCACTGGG + Intergenic
1185191291 22:49438153-49438175 CAGTGGCGCTAGGACCCACATGG - Intronic
950018692 3:9770885-9770907 GAGTGGCACTTGGAGGCCCTTGG - Intronic
951022267 3:17793663-17793685 GCCTGGCACTAGGATCCACTGGG + Intronic
952006155 3:28844949-28844971 GAATGGCCCTTGGAGCCAAAGGG + Intergenic
954288805 3:49638160-49638182 GAGAGGGCCTAGGAGCCACAGGG + Intronic
955393801 3:58540476-58540498 GTGTGGCCTAAGGACCCACTCGG + Intergenic
955602153 3:60657203-60657225 CAGTATCCCTAGGAGGCACTAGG + Intronic
955859300 3:63310663-63310685 GAGAGGCCATCAGAGCCACTGGG - Intronic
957534454 3:81483279-81483301 GGGTGGCACTTGAAGCCACTTGG - Intergenic
961083413 3:124045264-124045286 GAGTGGCTCTAGGAACAATTGGG + Intergenic
961449848 3:126997774-126997796 GGGTGGCCCTGCCAGCCACTGGG - Intronic
963847303 3:150172268-150172290 GAATGGCCCCAAGAGCCACTGGG + Intergenic
968044706 3:195617624-195617646 GAGTGGGCCAAGGAGCCTCTTGG - Intergenic
968060493 3:195723676-195723698 GAGTGGGCCAAGGAGCCTCTTGG - Intronic
970101190 4:12524415-12524437 GTATGGCCATAGGAGCCACATGG - Intergenic
971166235 4:24186681-24186703 GAGTACCCATTGGAGCCACTTGG + Intergenic
974316071 4:60282428-60282450 GAGTGGGCACAGCAGCCACTGGG + Intergenic
985793779 5:1947119-1947141 GAGTGTGCCCAGGAGCCACCGGG - Intergenic
986308822 5:6536154-6536176 GGGTGACCCTAAGAGCCCCTTGG + Intergenic
998001802 5:138631407-138631429 GAGCGGCCTTGGGAGCCAGTAGG + Intronic
999158070 5:149472632-149472654 GCTTGGCCCTAGGAGCCCCCTGG - Intergenic
1002211429 5:177601755-177601777 GCCTGGGCCTGGGAGCCACTGGG + Intronic
1002431797 5:179208294-179208316 GAGGGGCCCAAGGAGACACTGGG - Intronic
1003117254 6:3291224-3291246 GAGTGGCCCTCGGAAGCACAGGG - Intronic
1003533093 6:6954092-6954114 GAGTGGCCCTGGGCCCCACCAGG + Intergenic
1005354515 6:24969583-24969605 GAGGGGCCCTCTAAGCCACTAGG + Intronic
1005726762 6:28656899-28656921 GAGTGGCACTGAGGGCCACTGGG + Intergenic
1007109069 6:39302689-39302711 GTATGGCCCTTGGAGCTACTGGG + Intronic
1016014153 6:139166805-139166827 GACTGGCCCGGGGAGCCACCGGG - Exonic
1019279231 7:192043-192065 GAGAGGCCCAAGGAGCGACTGGG - Intergenic
1020360274 7:7320307-7320329 GACTGGCCCTAAGAGCCACTAGG - Intergenic
1023834158 7:44058686-44058708 GGGAGGCCCTGGGAGCCCCTTGG + Intronic
1024630701 7:51244578-51244600 GAGTGGCCGTAGGAGAGGCTGGG - Intronic
1026994373 7:74606190-74606212 TGGTGGCACTGGGAGCCACTAGG - Intergenic
1032091387 7:128913298-128913320 GAGTGGCCCTTGGAGGAATTTGG - Intergenic
1038256223 8:25953739-25953761 GAGTGGGCTTTGGAGCCAATAGG - Intronic
1041509078 8:58634379-58634401 GAGTGTCCCTAGGAGGCAGATGG - Intronic
1048694087 8:137004665-137004687 GGATGACCTTAGGAGCCACTTGG - Intergenic
1056599518 9:88035839-88035861 GAGTGGCTCCAGGAGCCGCCAGG + Intergenic
1057242241 9:93421558-93421580 AAGTGGCCCTGTGACCCACTGGG - Intergenic
1057705092 9:97390274-97390296 CAGTGAGCCTAGGAGGCACTGGG - Intergenic
1062345064 9:136110741-136110763 GGGGGGCTCTGGGAGCCACTCGG + Intergenic
1062547609 9:137070691-137070713 GAGTGGCCCTGGGAGGCGCGCGG + Intergenic
1062641431 9:137520728-137520750 GTGTGACCCTGGGAGGCACTTGG - Intronic
1186672697 X:11783064-11783086 GAGTGCCCCCAGGAGGCCCTTGG + Intergenic
1187407078 X:19013980-19014002 CAGTGGCCCGAGGCACCACTGGG + Exonic
1188924522 X:36023431-36023453 GAGTGGCTATAGGAGGCATTGGG - Intergenic
1189262881 X:39690169-39690191 AAGTGACCCTGGAAGCCACTGGG - Intergenic
1194981708 X:100447999-100448021 GAGTGTCCCTAGTGGCCACATGG - Intergenic
1199990932 X:152987497-152987519 CAGGGGCCCTGGGAGACACTCGG - Intergenic
1200034019 X:153316971-153316993 CAGGGGCCCTGGGAGACACTCGG - Intergenic
1200141925 X:153906785-153906807 GGCTGGTCCTGGGAGCCACTGGG + Exonic