ID: 1075606787

View in Genome Browser
Species Human (GRCh38)
Location 10:123817397-123817419
Sequence CATTATTTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 2, 2: 19, 3: 234, 4: 352}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075606787_1075606792 16 Left 1075606787 10:123817397-123817419 CCTGCCATCTTCTGCAAATAATG 0: 1
1: 2
2: 19
3: 234
4: 352
Right 1075606792 10:123817436-123817458 ACAGCACTTGGCCTGTTACTGGG No data
1075606787_1075606793 22 Left 1075606787 10:123817397-123817419 CCTGCCATCTTCTGCAAATAATG 0: 1
1: 2
2: 19
3: 234
4: 352
Right 1075606793 10:123817442-123817464 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1075606787_1075606791 15 Left 1075606787 10:123817397-123817419 CCTGCCATCTTCTGCAAATAATG 0: 1
1: 2
2: 19
3: 234
4: 352
Right 1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG No data
1075606787_1075606789 4 Left 1075606787 10:123817397-123817419 CCTGCCATCTTCTGCAAATAATG 0: 1
1: 2
2: 19
3: 234
4: 352
Right 1075606789 10:123817424-123817446 TCCTTTTGAGAGACAGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075606787 Original CRISPR CATTATTTGCAGAAGATGGC AGG (reversed) Intronic
901356009 1:8649780-8649802 CACTATTGTCAGTAGATGGCAGG + Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902311799 1:15586750-15586772 CATTTGTTCCAGAAAATGGCTGG - Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905369935 1:37477514-37477536 CATGATTTGCATATGATGGGGGG - Intronic
905652675 1:39667048-39667070 CACTATTCTCAGAATATGGCTGG + Intronic
905787131 1:40767244-40767266 TATTACTTGCAGAAGATGGGGGG + Intronic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
908355142 1:63321018-63321040 AAATATTTGCAGAAGATGCTGGG - Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911666543 1:100559283-100559305 CTTTATTTGCAGATGAAGCCTGG - Intergenic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
916898976 1:169200487-169200509 TATTATCTCTAGAAGATGGCTGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918094802 1:181325794-181325816 AAATATTTGCAGAAGATGCTGGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919442627 1:197655952-197655974 CATTATGTGCAGCAGATGAGTGG + Intronic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920947665 1:210544847-210544869 CATTACATGCACCAGATGGCAGG + Intronic
921524243 1:216197483-216197505 TATTATTTGTCCAAGATGGCTGG + Intronic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
922040340 1:221890194-221890216 CATTATTTCCAGAAAATGACAGG - Intergenic
922573465 1:226646985-226647007 CATTATTTGCAGAGGGTTCCGGG - Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
923641853 1:235771051-235771073 CATTATTGCCAGATAATGGCAGG - Intronic
923668909 1:236023182-236023204 CATTATTTGCAATAGCTGGAAGG + Intronic
923847109 1:237747192-237747214 CAGTATTTGAGAAAGATGGCTGG - Intronic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063528106 10:6803177-6803199 CAATATTTGCAGAAGGAGTCAGG + Intergenic
1063567845 10:7187480-7187502 GTTTATTTGCAGAAAATGGCAGG - Intronic
1064340740 10:14483219-14483241 CAATATTTGCTGAATGTGGCTGG - Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065086781 10:22186807-22186829 CATTATCTGGACAAGAGGGCTGG - Intergenic
1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG + Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072360467 10:94654141-94654163 AATTGTCTACAGAAGATGGCAGG - Intergenic
1073189757 10:101642981-101643003 TATTATTTGGGGAGGATGGCAGG - Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074761848 10:116672752-116672774 TCTTATTTGTAGAATATGGCTGG + Exonic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078118872 11:8485263-8485285 CAATTTTTGCAGAAGAGGTCTGG - Intronic
1078238247 11:9505961-9505983 TAATATTTGGAGAAAATGGCTGG + Intronic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081640731 11:44751776-44751798 AATTATTTGGACATGATGGCAGG + Intronic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083081484 11:60098712-60098734 AATTATTGACAAAAGATGGCTGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083102732 11:60326769-60326791 AATTCTGTGCAGAAGAAGGCAGG - Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088589090 11:111387295-111387317 CCATATTTGCAGATGATGTCTGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089026300 11:115274082-115274104 CTTTACCTGCAGAAGTTGGCTGG - Intronic
1089903604 11:122013580-122013602 GTTAATCTGCAGAAGATGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1092065426 12:5586348-5586370 CGCCATTTGGAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098088398 12:66873353-66873375 CTTTATTTTCCGAAGATGGATGG - Intergenic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099298085 12:80856083-80856105 CTTTTTTTGCAAAAAATGGCTGG - Intronic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099609900 12:84855418-84855440 CATTTTTTGTAGAAGAGGTCGGG + Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101195525 12:102378024-102378046 CATGATTTCCAGAAGATGCTTGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103659971 12:122506397-122506419 CATAATATGTAGAAGATGTCAGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106689093 13:32094859-32094881 CAGTATTTGGAAAAGATTGCTGG + Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108313374 13:49217009-49217031 CATTATGTGCACCAGAAGGCAGG - Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109062835 13:57640697-57640719 GATTCTTTTGAGAAGATGGCAGG + Intronic
1109748326 13:66656050-66656072 CACTATCTGAAGAAGAAGGCAGG + Intronic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110014898 13:70387597-70387619 CATTTTTGGGAGAAGATGACAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115430357 14:33310367-33310389 CATTATTTCCAGAAAATTACTGG + Intronic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116763372 14:49041492-49041514 CATCTATTGCAGAAGATGACTGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119692504 14:76687380-76687402 CATTATTTACTGAAAATGTCTGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1120932725 14:89865474-89865496 CTTTATTTGAAAAGGATGGCTGG + Intronic
1123219532 14:106843145-106843167 CAAAATTTGCAGAAGATGGAAGG - Intergenic
1126250594 15:46563823-46563845 CATTTTTTGCAGGAGAGGTCTGG + Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127389954 15:58497434-58497456 CATTATTTGCTGTGGAGGGCAGG - Intronic
1127868554 15:63051120-63051142 CATTATTTAAAGAAAAAGGCAGG + Intronic
1127933606 15:63614654-63614676 CTTTATTTGCAGAATATGTTGGG - Intronic
1130101476 15:80897665-80897687 CATTATTTGCAAAAGGTTTCAGG + Intronic
1130279659 15:82510555-82510577 CACCATTTGCAGAAGAAAGCAGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1131835796 15:96389622-96389644 CATTGTTTCCAGCAGTTGGCAGG - Intergenic
1134284295 16:12846730-12846752 CAGTAATTCCAGAAGATGGAAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1137298531 16:47122193-47122215 CATGAGTAGCAGAGGATGGCAGG + Intronic
1137849864 16:51731038-51731060 CATAATTTGCATATGATGCCAGG + Intergenic
1138485712 16:57341840-57341862 CATTATTTGCAGAGCCTGGCTGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141913045 16:87073303-87073325 CATTATTTACAGATGAAGGACGG - Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146643296 17:34557117-34557139 CAGTATTTGCAGAAGCTGGGAGG + Intergenic
1150140302 17:62722730-62722752 CATTTTCTACAGAAGATGGCTGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151133943 17:71926988-71927010 GATTATTTTCAGCAGATGGATGG - Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153184388 18:2470716-2470738 AATTATTTGTGGAGGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158019769 18:52827679-52827701 TACTATTTGCAGACAATGGCAGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159802723 18:72920842-72920864 CATTATTTGTATAAGGTGGCAGG - Intergenic
1159971893 18:74665617-74665639 CATTACATTAAGAAGATGGCAGG - Intronic
1160439291 18:78876682-78876704 AATTGTTTCCAGAATATGGCAGG + Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165426227 19:35746843-35746865 CAGTATGTGCAGAAGTTGTCAGG - Exonic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
925631442 2:5897703-5897725 AAGTATTTGCAGCTGATGGCAGG + Intergenic
926804985 2:16700006-16700028 CATGATTTACTGACGATGGCAGG - Intergenic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928265335 2:29806617-29806639 CAATATTTGCAGATGTTGTCCGG + Intronic
928301861 2:30132157-30132179 AAATACTTGCAGAAGATTGCAGG - Intergenic
929295933 2:40246674-40246696 CATTAATTCCAGAAGATGGATGG + Intronic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935291002 2:101610968-101610990 CAAAATTTGCAGCAGAAGGCAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935942985 2:108260627-108260649 CATTATGAAAAGAAGATGGCAGG + Intronic
936869660 2:117120298-117120320 CCTTATTTGCAGATGATGATAGG - Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
937872357 2:126795242-126795264 CATTATTTTAAAAAGATGGAAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939347322 2:140982694-140982716 CATTATTTGGAGACGATCTCAGG + Intronic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939757159 2:146128922-146128944 CACTTTTTTCACAAGATGGCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942437077 2:175990370-175990392 CATTCTTGGCAGAAGGTGACAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943695214 2:190921151-190921173 CAGTTTTTGAATAAGATGGCTGG + Exonic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945580126 2:211583225-211583247 TATTATTTTTAGAATATGGCTGG - Intronic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946587187 2:221202999-221203021 CATTATTTACAAAAGAAGACAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948948505 2:241234122-241234144 CATTATTAGCAGATAATGGAAGG - Intronic
1169246701 20:4031584-4031606 CATTATTTGCAGAAGATATGAGG - Intergenic
1172377958 20:34461412-34461434 CAAAAAATGCAGAAGATGGCTGG + Intronic
1174915128 20:54645650-54645672 CATAAGATGCAGATGATGGCCGG + Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1182203047 22:28593030-28593052 CATTATTCTCTGAAGGTGGCTGG + Intronic
1182242783 22:28930421-28930443 CATGAATTTCAGAATATGGCAGG - Intronic
1182392173 22:30007585-30007607 CAGTATCTGCAGACCATGGCAGG + Intronic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
949868262 3:8564910-8564932 AATGACTTGCAGAAGATTGCTGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951593331 3:24290324-24290346 CGTTGTTTGCAGAACATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952649761 3:35711284-35711306 CATGATTTGCAAATGATGTCTGG - Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956201328 3:66709359-66709381 GATTATTAGCAGAAAATGACAGG + Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959831226 3:110865120-110865142 CAATATTGGCACAAGATTGCTGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961500103 3:127326380-127326402 CATTCCTTGCAGCAGATGTCAGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964553828 3:157914013-157914035 CAATATTTGAAGAAGAAGACTGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965105896 3:164352552-164352574 CATAATTCCCAGAAGATGACTGG + Intergenic
965204691 3:165706272-165706294 CATTATTTGCAAAAGTTCCCTGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
970276350 4:14405168-14405190 CAACATTTGCAGAGGTTGGCAGG - Intergenic
970592456 4:17571328-17571350 CACTCTTTGCAGAAGCTGGTGGG - Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972095490 4:35342661-35342683 AGTTACTTGCAGAAGACGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG + Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977919425 4:102626819-102626841 CATAATTTGCTGAAGTGGGCTGG - Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978899080 4:113926848-113926870 TGTTATCTGCAGAAGACGGCAGG + Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981642818 4:146965356-146965378 CATTATTTTCAGCAGAGAGCTGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983796460 4:171869852-171869874 CAATCATGGCAGAAGATGGCAGG - Intronic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984292343 4:177811425-177811447 CATTATTTGATGCAGATGGTAGG - Intronic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986173943 5:5336087-5336109 CATTGTTTGCAGACGCTGTCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988519371 5:31931936-31931958 CATTAATGGCAGAAGTTGGAAGG + Intronic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
988866399 5:35339790-35339812 CATTACTTCAAGAAGATGCCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991229240 5:64311736-64311758 GATTATTGGTAGAAGATGGTAGG - Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994539518 5:101076899-101076921 ATTTAATTGCAGATGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
999935404 5:156480696-156480718 CATTATCTCCAGAAGAGAGCAGG - Intronic
1000128088 5:158267172-158267194 TATTATTTGCAACAGATAGCTGG + Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002437957 5:179244318-179244340 CATTATTAGGAGAAGTCGGCTGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003326111 6:5092413-5092435 CATTATTTTTAAAAAATGGCCGG + Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010601389 6:77831595-77831617 CATCATTTGCAGAGCATGGATGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014609290 6:123521437-123521459 CATCATTTGAAGATGAAGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014892105 6:126855328-126855350 CATAAACTACAGAAGATGGCCGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016088658 6:139947334-139947356 CATAAAATGCAAAAGATGGCCGG + Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017747335 6:157458652-157458674 CATTGTTTGCAGACCATGCCAGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021684091 7:23164880-23164902 GATTATTTTCAGAAAATAGCAGG + Intronic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1022892104 7:34711907-34711929 CAAGGTTTGCAAAAGATGGCTGG + Intronic
1023118145 7:36882848-36882870 CATTGTTTCCAAAAGATGGAGGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032846553 7:135756430-135756452 CCTTATTTGCTAAAGAAGGCAGG + Intergenic
1033030094 7:137818090-137818112 GAATATTTTGAGAAGATGGCAGG + Intronic
1033218096 7:139508744-139508766 CATTTTTTGAAGAAAATGGGCGG + Intergenic
1034135210 7:148761730-148761752 CTTTATTTACAGAAAAAGGCAGG + Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1037184833 8:16050303-16050325 TAATATTTGCTGGAGATGGCTGG - Intergenic
1037293111 8:17372198-17372220 CATTTTTAGCAGAAGGTGGCAGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038254516 8:25938804-25938826 CATTACTTGGAAAATATGGCTGG + Intronic
1039893340 8:41699093-41699115 CAAAAGTTGAAGAAGATGGCCGG - Intronic
1040828845 8:51654813-51654835 CATTATTTCCAGAAGCTTGAAGG + Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041601732 8:59725931-59725953 CATTTTTTCCAGAACCTGGCAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042152567 8:65804287-65804309 CATGATTTCCTGAACATGGCTGG + Intronic
1042813539 8:72852629-72852651 CATTTTTTGCACAGGATGGCAGG + Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045990052 8:108296165-108296187 CATTATTTGCAGCAGAACGTAGG + Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046274131 8:111934767-111934789 CATTATATGCAGATCATGGTTGG - Intergenic
1046312665 8:112458987-112459009 CATTGTTTGTAGAAGATAGTAGG - Intronic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046807403 8:118494876-118494898 CATTATTTGGGGTAGATGGAAGG - Intronic
1046815553 8:118579623-118579645 CATTATTTGGAGGAGAAGGGAGG + Intronic
1046903557 8:119547858-119547880 CCTTAATTACAGAAGATGGCTGG - Intergenic
1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG + Intergenic
1050280829 9:4048297-4048319 CATGTTTAGCAGAAGATGGAAGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051422893 9:16906014-16906036 CCTCCTTTGCAGAAGCTGGCTGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052364691 9:27599026-27599048 CACTATTTGTACAAGATGTCTGG + Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1054702315 9:68425288-68425310 AATTGTTTTCAAAAGATGGCAGG + Intronic
1054834657 9:69664113-69664135 AACTATTTGGAGAAGATAGCCGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1056902172 9:90609869-90609891 CATTATTTCCAGAACATCACTGG + Exonic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058248577 9:102662211-102662233 CAATTTTTGCAGAAGATCGGAGG - Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059819542 9:117956806-117956828 AATTAGTTGCAGAAGTAGGCAGG + Intergenic
1059869368 9:118554668-118554690 CATAATTTGGGGAAGATGGCAGG - Intergenic
1062104161 9:134743678-134743700 CATTATGTGCAGAAGCAGCCTGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062161345 9:135081902-135081924 CATGCTTTGCACAAGGTGGCTGG + Intronic
1185828097 X:3272285-3272307 CATTCTTTGCAGAAAAATGCTGG + Exonic
1186112084 X:6269153-6269175 GACTATTTGCAGAAGGTTGCTGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187081469 X:15993728-15993750 CTTTATTTTCTGAAGATGGGGGG + Intergenic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1187700201 X:21957580-21957602 CATTATTTGAAAAAGAAGGCCGG - Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190435876 X:50424614-50424636 CTCTATTTGCAGTAGAGGGCAGG + Intronic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192590312 X:72354190-72354212 CATTCTTTGCTGAAGCAGGCTGG + Intronic
1192661133 X:73044161-73044183 CATTATTTCAATAAGATGTCAGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194565590 X:95484161-95484183 CATTATCTGAAGAAGAGGTCAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195054511 X:101130470-101130492 TATTATTTACAAAAGATGTCAGG - Intronic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196666515 X:118322886-118322908 CATTATTGGAGGAAAATGGCAGG - Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199661482 X:150054777-150054799 CAATATCTGCAGAACATAGCAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic