ID: 1075606791

View in Genome Browser
Species Human (GRCh38)
Location 10:123817435-123817457
Sequence GACAGCACTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075606787_1075606791 15 Left 1075606787 10:123817397-123817419 CCTGCCATCTTCTGCAAATAATG 0: 1
1: 2
2: 19
3: 234
4: 352
Right 1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG No data
1075606788_1075606791 11 Left 1075606788 10:123817401-123817423 CCATCTTCTGCAAATAATGACTC 0: 1
1: 1
2: 26
3: 231
4: 413
Right 1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG No data
1075606786_1075606791 16 Left 1075606786 10:123817396-123817418 CCCTGCCATCTTCTGCAAATAAT 0: 1
1: 19
2: 198
3: 196
4: 374
Right 1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075606791 Original CRISPR GACAGCACTTGGCCTGTTAC TGG Intronic
No off target data available for this crispr