ID: 1075607185

View in Genome Browser
Species Human (GRCh38)
Location 10:123820444-123820466
Sequence TGCTCACTAGTGTCCCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075607183_1075607185 2 Left 1075607183 10:123820419-123820441 CCCTAAACTCACTGACACACATG 0: 1
1: 0
2: 1
3: 21
4: 239
Right 1075607185 10:123820444-123820466 TGCTCACTAGTGTCCCACTTTGG No data
1075607182_1075607185 3 Left 1075607182 10:123820418-123820440 CCCCTAAACTCACTGACACACAT No data
Right 1075607185 10:123820444-123820466 TGCTCACTAGTGTCCCACTTTGG No data
1075607181_1075607185 7 Left 1075607181 10:123820414-123820436 CCTGCCCCTAAACTCACTGACAC 0: 1
1: 1
2: 0
3: 21
4: 206
Right 1075607185 10:123820444-123820466 TGCTCACTAGTGTCCCACTTTGG No data
1075607184_1075607185 1 Left 1075607184 10:123820420-123820442 CCTAAACTCACTGACACACATGT 0: 1
1: 0
2: 0
3: 41
4: 333
Right 1075607185 10:123820444-123820466 TGCTCACTAGTGTCCCACTTTGG No data
1075607180_1075607185 12 Left 1075607180 10:123820409-123820431 CCATTCCTGCCCCTAAACTCACT 0: 1
1: 0
2: 4
3: 31
4: 395
Right 1075607185 10:123820444-123820466 TGCTCACTAGTGTCCCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075607185 Original CRISPR TGCTCACTAGTGTCCCACTT TGG Intronic
No off target data available for this crispr