ID: 1075608240

View in Genome Browser
Species Human (GRCh38)
Location 10:123831805-123831827
Sequence TAGGGTAGAAAAGATTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075608240 Original CRISPR TAGGGTAGAAAAGATTTTTC TGG (reversed) Intronic
901116605 1:6850494-6850516 GAGAGTAGGGAAGATTTTTCTGG + Intronic
904046233 1:27610344-27610366 TAGGGCAGACAAGAATATTCTGG + Intergenic
904331999 1:29765884-29765906 TTGGGTAGGAAAGATTTCTTAGG + Intergenic
904912529 1:33945977-33945999 TGGGGTAGAAAATTATTTTCCGG + Intronic
905114970 1:35630706-35630728 TAGAGTACAAAGGATTTTTAGGG + Intronic
905944495 1:41890340-41890362 TAGGGTAGAAAAGATGCTCGGGG + Intronic
905987605 1:42301094-42301116 AAGTGTAGAAAAGCTATTTCAGG - Intronic
907630790 1:56079816-56079838 TGGAGTAGAAGAGATCTTTCAGG + Intergenic
908304489 1:62798121-62798143 TGGGGTAGAAAAGGCCTTTCTGG - Intronic
909268190 1:73589320-73589342 AAGAGTAGAAAAGATTTTCCAGG - Intergenic
909304397 1:74054399-74054421 GAGTGTAGAAAGGATTTTTAGGG + Intronic
910469789 1:87539652-87539674 CAGGGGATAAAAGATTATTCTGG + Intergenic
910653788 1:89599552-89599574 TAGAGTAGAAATGCTTTTTTAGG + Intergenic
910662394 1:89687804-89687826 TGGGGTAGATGTGATTTTTCGGG + Intronic
911967702 1:104388130-104388152 TAGGGCAGCAAAAATTTTTGGGG - Intergenic
917156820 1:172011272-172011294 CAGGGGAGAAAAGAACTTTCAGG - Intronic
919716573 1:200783884-200783906 TAGGCAAGAAAAGATTTCTTAGG - Intronic
920082097 1:203382311-203382333 TAGGATAGCACAGAATTTTCTGG + Intergenic
923349548 1:233090138-233090160 TGGGGTAGAAAAGATTGATGTGG + Exonic
923975143 1:239254738-239254760 TAGGGTACAAATAATTTTTAAGG - Intergenic
1063737274 10:8773271-8773293 TAGTGTAGAAATGTTCTTTCCGG + Intergenic
1065138297 10:22694449-22694471 TATGGTACAAAACATTTTTGGGG - Intronic
1065534156 10:26701237-26701259 TGTGATAGAAAAGAATTTTCTGG + Intronic
1065592956 10:27284284-27284306 TAGACTAGAAAAGACTTTTATGG + Intergenic
1065878230 10:30016073-30016095 AAGGCTTGGAAAGATTTTTCGGG + Exonic
1066573076 10:36794103-36794125 TAGGGAAGAAAACCTATTTCTGG - Intergenic
1067961341 10:50854106-50854128 TAAGGTAGAAAAGATTTCTAAGG - Intronic
1070427759 10:76305896-76305918 TAAAGGAGAAAAGATTTTTGGGG + Intronic
1072417231 10:95259381-95259403 TGAGATAGGAAAGATTTTTCTGG - Intronic
1072811251 10:98463816-98463838 AAAGGTAGAAAACATTTTTCAGG + Intronic
1072862166 10:99017941-99017963 TAGGGTAGTAAAAGTTTTTAAGG - Intronic
1073156717 10:101353486-101353508 TGGGGGAGAAAAGATTCCTCGGG + Intergenic
1073734626 10:106331595-106331617 TAGGATAGAAAATATTTCTTTGG + Intergenic
1075608240 10:123831805-123831827 TAGGGTAGAAAAGATTTTTCTGG - Intronic
1078748151 11:14135079-14135101 TAGAGTAGAAAGGACTGTTCTGG - Intronic
1080027550 11:27630075-27630097 TAGGGATGACAAGATTTTTGGGG + Intergenic
1080101120 11:28460769-28460791 AAGGGTAGAGAAGATTTTCCTGG + Intergenic
1080629766 11:34063322-34063344 TAAGGCACAAATGATTTTTCTGG + Intronic
1080945130 11:36964193-36964215 TAGGGAAGAGAAGACTTTGCAGG + Intergenic
1081442380 11:43094336-43094358 TAGGAGAGAAAAGAATTTTGGGG + Intergenic
1085508242 11:77072214-77072236 TGGGGGAGGAAAGATTATTCTGG - Intronic
1086253486 11:84846309-84846331 TGGGGTAGAAAAGAGGTTTGAGG - Intronic
1087136567 11:94726746-94726768 GAGCCTAGAAAAGAGTTTTCAGG - Intronic
1088115939 11:106313871-106313893 TAGGATATAAAAGATTTTTAAGG + Intergenic
1088263110 11:107963583-107963605 GAATGCAGAAAAGATTTTTCTGG + Intergenic
1090111327 11:123911911-123911933 TAGGATCCAAAAGAATTTTCTGG - Intergenic
1090127612 11:124104612-124104634 TAATGTAGAAAAGAGTTTTGAGG - Intergenic
1090314669 11:125775075-125775097 TAAAGTATAAAAGATTTTTTAGG - Intergenic
1090543900 11:127740251-127740273 TAGGGGAAAAAAGTTTTTCCAGG - Intergenic
1090904133 11:131059155-131059177 TTGAATAGAAAGGATTTTTCAGG - Intergenic
1093082598 12:14830377-14830399 TAAGGTAGAAAAGATGTTTCTGG + Intronic
1093440380 12:19188531-19188553 TAGATTAGAAATGATGTTTCTGG + Intronic
1093584178 12:20818050-20818072 TAGGGATGAAAAGTTTTTTTGGG + Intronic
1094065600 12:26358054-26358076 CAAGGCAGAAAAGATTTATCTGG + Intronic
1094080400 12:26528400-26528422 TAGGATAGAAACTATTTTTCTGG - Intronic
1094733638 12:33207600-33207622 AAGGATAGAAAAGATATATCAGG - Intergenic
1094820164 12:34218642-34218664 TAAGGTAGAACAGATCTCTCTGG - Intergenic
1094826292 12:34271656-34271678 TAGGGATGACAAGATTTTTTGGG - Intergenic
1095498050 12:42806423-42806445 TTGTGAAGAGAAGATTTTTCAGG + Intergenic
1099129005 12:78803275-78803297 TAGATTAGAAAGGATCTTTCTGG - Intergenic
1099629501 12:85124202-85124224 TAGGGGCCAAATGATTTTTCTGG - Exonic
1101219416 12:102621840-102621862 CAAAGTATAAAAGATTTTTCAGG + Intergenic
1102696997 12:114807823-114807845 TAGAGTTGAAAGGATTATTCTGG + Intergenic
1102833728 12:116033019-116033041 TGGGGTAGAAAAAAGGTTTCTGG + Intronic
1102976810 12:117212670-117212692 TAGGGTTGACAAGATATTTGGGG - Exonic
1103636323 12:122309565-122309587 TAGGGTAGGAGAGATTTGACAGG - Intronic
1104325378 12:127791124-127791146 TTGGGCAGAAAAGCTCTTTCTGG - Intergenic
1104526360 12:129526718-129526740 TAGGGTTGAAAAGAGCTTCCAGG + Intronic
1106222421 13:27757574-27757596 TAGGTTGGAAATGTTTTTTCTGG + Intergenic
1107114303 13:36730327-36730349 TAGTGGAGAAAAGATTTTATTGG - Intergenic
1107777160 13:43856789-43856811 AAGGGTAGAAGAGAACTTTCTGG + Intronic
1109329894 13:60916531-60916553 CAGGGTAGACAAGATTGTCCAGG - Intergenic
1109509791 13:63354738-63354760 AAGGGAAATAAAGATTTTTCTGG + Intergenic
1111068304 13:83127792-83127814 TATGGTAGAAAAAATATTTAAGG - Intergenic
1111965480 13:94857545-94857567 AAAGGTAGAAATGAATTTTCTGG + Intergenic
1112464753 13:99633950-99633972 TAGGGCAGAAAAAATATTTGAGG + Intronic
1112603995 13:100885859-100885881 CAGGGTTGACAAGCTTTTTCTGG - Intergenic
1112819465 13:103314514-103314536 TGGAGTAGAAAAGATGGTTCAGG + Intergenic
1113312922 13:109149745-109149767 GTGGGTAGAAAGGATTTTCCAGG - Intronic
1114879873 14:26771097-26771119 TATGGTGGAAGAGATTGTTCTGG - Intergenic
1114977758 14:28123208-28123230 GAGGAGAGGAAAGATTTTTCGGG - Intergenic
1117312651 14:54543425-54543447 TTAGGTAGAAAAGAGATTTCAGG + Intergenic
1117646583 14:57859647-57859669 TAGGGAAGTAAATATTTTTAAGG + Intronic
1117805742 14:59489115-59489137 TAGAGAAGAAAAGCATTTTCAGG - Intronic
1119830886 14:77701517-77701539 TAGGGAAGAAAAGACTTATGGGG - Intronic
1120539120 14:85733399-85733421 TAGGGATGACAAGATTTTTGGGG + Intergenic
1121136375 14:91502561-91502583 TAGGGTGGAAAAGCTTTTGGGGG - Intronic
1121704048 14:95977881-95977903 TAGGGTTGACAAGTTTTTTGGGG - Intergenic
1121864474 14:97349804-97349826 TAATCTAGAAAATATTTTTCTGG - Intergenic
1125266386 15:37886362-37886384 CATGTTAGAAAAGCTTTTTCTGG - Intergenic
1125535714 15:40440554-40440576 GGGGGGAGATAAGATTTTTCCGG + Intronic
1128679124 15:69634796-69634818 TATTGTAGAAAACATTTTTAAGG + Intergenic
1131791987 15:95975115-95975137 TAGGGAAGGATAGATTTTTGTGG - Intergenic
1132275877 15:100563575-100563597 GAGGCTAGAAGAGACTTTTCTGG - Intronic
1137300866 16:47146163-47146185 TAGAGGAAAAAAGATTTTTTAGG - Intergenic
1138805307 16:60083547-60083569 TAGGGAAGACAAGTTTTTTTGGG - Intergenic
1140557869 16:75942389-75942411 TACAGCAGAAATGATTTTTCTGG + Intergenic
1140877782 16:79168990-79169012 AAGGGGTGAAAAGATTTTTAAGG - Intronic
1141459300 16:84168031-84168053 TAGGGTAAAACAGATTTGTGGGG - Intronic
1143996192 17:11008450-11008472 AAGGGTAGAAACCATTTTTCTGG + Intergenic
1148137859 17:45306955-45306977 TATTGTATAAAAAATTTTTCAGG + Intronic
1149020375 17:51956685-51956707 TAGGGTAGAAAAGAAATTATGGG + Intronic
1149201690 17:54193947-54193969 TATGGCAGAAAATATTGTTCTGG - Intergenic
1149303038 17:55322786-55322808 CAGGGTAGAAAAGAACTGTCTGG - Exonic
1149537628 17:57444707-57444729 AAGGGCAGAAATGATTATTCTGG + Intronic
1149585703 17:57784855-57784877 TAGGATGGGAAAGATTTCTCAGG - Intergenic
1151241096 17:72758538-72758560 TAGGGAAGGAAAGACTTTCCAGG - Intronic
1152499065 17:80696069-80696091 TAGGGCAGGATAGATTTTTCCGG + Intronic
1153091020 18:1342996-1343018 TAGGGAAGCAAAGATTTCTTAGG + Intergenic
1153990125 18:10389360-10389382 TAGTCTAGAAAATATATTTCTGG + Intergenic
1154481118 18:14825875-14825897 TAGGGGAGAGAAGAAATTTCAGG + Intronic
1156009972 18:32485849-32485871 TAGGATAGAAATGATTCTGCAGG + Intergenic
1157052167 18:44179057-44179079 AAGGATAGAGAAGATTCTTCTGG - Intergenic
1157420809 18:47546293-47546315 TAAAGGAGAAAAGAATTTTCTGG + Intergenic
1157880376 18:51316057-51316079 TATGGTATAAATGATTTTCCAGG + Intergenic
1157992826 18:52518085-52518107 TAAGGTATCAAAGATTTTTTAGG - Intronic
1158101921 18:53839446-53839468 TAGCAGAGGAAAGATTTTTCTGG - Intergenic
1158367578 18:56755807-56755829 GAGGGTAATAAAGATTTATCTGG - Intronic
1158451643 18:57571589-57571611 TTGAGTAGAAAACATTTCTCAGG - Intronic
1158830824 18:61276625-61276647 GAGCTTAGAAAAGATATTTCAGG + Intergenic
1158997422 18:62937036-62937058 TATTGTAAAAATGATTTTTCTGG - Intronic
1159351162 18:67274413-67274435 TAGGGAATAAAATAATTTTCTGG + Intergenic
1159819144 18:73117763-73117785 TAGGGTAGAAGAGATTTGGGAGG + Intergenic
1164123028 19:22285350-22285372 TTTGGCAGAAAAGTTTTTTCAGG + Intergenic
1164524306 19:29002156-29002178 AAAAGGAGAAAAGATTTTTCGGG + Intergenic
925260885 2:2527481-2527503 TGGGGTAGAAATTATTCTTCAGG + Intergenic
927535256 2:23851736-23851758 CAGAGTATAAAAGATTTTTTAGG - Intronic
928867280 2:35932157-35932179 TAGAGTGGAAAAGCTTTTTTAGG - Intergenic
929697351 2:44129615-44129637 TAGTGGAAAAAAGATTTTGCTGG + Intergenic
930589300 2:53308287-53308309 CAGGGTCAGAAAGATTTTTCAGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932385200 2:71325970-71325992 TAAGATAAAAAATATTTTTCTGG + Intronic
933332067 2:80905535-80905557 TGTGGAACAAAAGATTTTTCAGG - Intergenic
933420522 2:82040066-82040088 GAGGTTTGGAAAGATTTTTCTGG + Intergenic
933517506 2:83324240-83324262 TAGGGTACAAATGCTTTTTAAGG + Intergenic
933710583 2:85322744-85322766 TAGGGGAAAAAAGATCTTTTAGG + Exonic
934943243 2:98517681-98517703 TAGGTAAGAAAAGAATGTTCTGG - Intronic
936883681 2:117283452-117283474 TAGGGATGACAAGTTTTTTCGGG - Intergenic
937371407 2:121300138-121300160 TAGTGCAGAAAAGATTTGACAGG + Intergenic
937745408 2:125406558-125406580 TTGGTTAGAAAATGTTTTTCAGG + Intergenic
938838452 2:135133155-135133177 TTGGGTAGCAAGAATTTTTCTGG + Intronic
939851330 2:147309329-147309351 TATACTAGAAAAGATTTTTTAGG - Intergenic
940270540 2:151885082-151885104 AAGGGTAGCATAGATTTTCCTGG + Intronic
940296020 2:152125235-152125257 GAGGGTAGGAAAGATTTTTCTGG - Intronic
941935498 2:170978418-170978440 TAGGGAAGACAAGTTTTTTGGGG + Intergenic
942421146 2:175809277-175809299 CAGGGTAGAAAAGAGATTTAGGG + Intergenic
942933444 2:181525043-181525065 TATGGTAGTAAAAATTTTTTAGG - Intronic
943451595 2:188048719-188048741 TAGGATAAAACAGATTTTTGTGG - Intergenic
943592376 2:189814429-189814451 TTGGGGGGAAAAGATTTTTGTGG - Intronic
943917800 2:193660003-193660025 TAGGGTAAAAAATATATATCTGG + Intergenic
943944295 2:194039240-194039262 TAGAGCAGAAAGGATTTTTAAGG + Intergenic
944754719 2:202749166-202749188 AAGGATAGTAAAGATTTTTCAGG - Intronic
945338910 2:208627962-208627984 CAAGGTAGAAAGGATCTTTCTGG - Intronic
945376525 2:209083346-209083368 TAGGGTTGACAAGTTTTTTGGGG - Intergenic
946046163 2:216822886-216822908 AAGTTTAGAAAACATTTTTCAGG + Intergenic
946096656 2:217280471-217280493 TAGGGCAGAAAAGGTGGTTCTGG + Intergenic
946273374 2:218612384-218612406 TCAGGAAGAAAAGATTTTGCTGG - Intronic
946306708 2:218860376-218860398 GTGGGTAGGAAAGATCTTTCGGG + Intronic
946921688 2:224586303-224586325 AATGGTAGAAATGATTTATCCGG - Intergenic
947507030 2:230715556-230715578 TAGTGTAGAGACTATTTTTCAGG - Intronic
1169106621 20:3001689-3001711 AAAGGAAGAAAAGATTTTCCTGG - Intronic
1169582669 20:7041882-7041904 AAGGGTACAAAAGAAGTTTCTGG - Intergenic
1169955663 20:11100031-11100053 AAGGGAAGAAAATATTTATCAGG + Intergenic
1173035578 20:39406087-39406109 TAGGTGAGAAATGATTATTCTGG - Intergenic
1175406239 20:58731616-58731638 TGGGGTAGAAAAATCTTTTCAGG + Intergenic
1177318407 21:19491007-19491029 TAGGGAAGAATGCATTTTTCTGG + Intergenic
1177790245 21:25715108-25715130 TAGGGGAGAAAAGAGGATTCTGG - Intronic
1179006581 21:37520674-37520696 TCAGGTAGATAAGATATTTCTGG + Intergenic
951335952 3:21421967-21421989 TAGGGGAGAAAAGGTATTTTTGG - Intronic
951695164 3:25438744-25438766 TAGGGCATGAAACATTTTTCAGG - Intronic
952124893 3:30289175-30289197 TAGAGAAGAAAATAATTTTCAGG - Intergenic
952458366 3:33496861-33496883 CTGAGGAGAAAAGATTTTTCAGG - Intronic
952558747 3:34564430-34564452 TAGGGTAGAAAGAATATTTCTGG - Intergenic
953457524 3:43054736-43054758 TAAGGTACTAAAGAATTTTCTGG + Intronic
955120264 3:56051056-56051078 TTGGGTAGAAAGTACTTTTCAGG - Intronic
955399229 3:58579380-58579402 TTGGGTATAAAACAATTTTCTGG + Intronic
956770014 3:72517398-72517420 TGGGGTGGAAAAGATCTTCCTGG - Intergenic
957368066 3:79252464-79252486 AAGGCAAGAAAAGATTCTTCTGG + Intronic
958681701 3:97340181-97340203 AATGGTAAAAAATATTTTTCAGG + Intronic
959119432 3:102215387-102215409 TGAGGTACAAAAGATTTTTATGG + Intronic
959614664 3:108333971-108333993 ATGGGAAGAAAAGATTCTTCTGG - Intronic
960467383 3:118013922-118013944 TAGGGTTGAATAGAATCTTCTGG - Intergenic
961131789 3:124475256-124475278 TAGGGAAAAACAGATTTTTTGGG + Intronic
963137593 3:141921675-141921697 GAGGGCAGATAAGATTTTACAGG + Intronic
963563847 3:146902594-146902616 TAGGGGAGAAAAGATATGCCAGG + Intergenic
964226223 3:154406210-154406232 TAGGAGAGAAATGATTTCTCAGG - Intronic
965874186 3:173297618-173297640 AGGGGTGGAAAAGATATTTCAGG - Intergenic
965875266 3:173310034-173310056 TAGGGAAGAAAAGATTCAACAGG - Intergenic
966288935 3:178331975-178331997 TAGGGTGGAAAAGTATATTCTGG + Intergenic
966698562 3:182819495-182819517 TCTGGTAGAAAAGATTTCACGGG - Intronic
967146138 3:186607950-186607972 CAGGATAGAAAAAATGTTTCTGG - Intergenic
967289811 3:187908456-187908478 ATGGGGAGAAGAGATTTTTCTGG + Intergenic
967480347 3:189965683-189965705 TAGGATAGAAAAGACTTCTGAGG + Intronic
967532932 3:190569934-190569956 TATGGTAGAAATGAATATTCAGG - Intronic
969653661 4:8483398-8483420 TAGGGTTGACAAGTTTTTTTGGG + Intronic
971830178 4:31682408-31682430 AAGGGTAGCACAGATATTTCTGG + Intergenic
972116185 4:35637174-35637196 TATGGTAGAATATATTTCTCTGG - Intergenic
972142218 4:35974849-35974871 TAGGGAAGATAAAATTTTCCTGG + Intronic
974610455 4:64209225-64209247 AAGGGGAGAAAACTTTTTTCTGG - Intergenic
974655998 4:64823025-64823047 TAGGGTTTAATAGATCTTTCTGG + Intergenic
976280847 4:83325741-83325763 TTGGATAGAGAAGGTTTTTCAGG + Intronic
976811011 4:89101314-89101336 GAGGGTAGAAAAGATTTAGTGGG - Intronic
977431206 4:96932315-96932337 CAGTGTAGAAAATATATTTCAGG - Intergenic
977613628 4:99062909-99062931 TTGAGTAGAAATGTTTTTTCAGG + Intergenic
977777444 4:100938305-100938327 TAGGATACAAAAGATTTTCTAGG + Intergenic
978139750 4:105305168-105305190 TAGGGCACAGAAGATTTTTAGGG + Intergenic
978642038 4:110882138-110882160 AAGGGAAGAACAGATTTTTTGGG + Intergenic
979173664 4:117634872-117634894 TATTTTAGAAAAGATTTGTCTGG - Intergenic
981266911 4:142795841-142795863 TAGGATATAAAAGATTTTAAAGG - Intronic
982283336 4:153708722-153708744 AAGGGGAGAAAACATTTTCCTGG - Intergenic
982519608 4:156397507-156397529 TACTGTAGAAAACATTTTTAAGG + Intergenic
982979529 4:162114701-162114723 TTGGGTAGATAAAATATTTCAGG - Intronic
983659930 4:170121168-170121190 TAGGGATGAAAAGTTTTTTGGGG - Intergenic
984866763 4:184287583-184287605 TGAGGTAGAAAAGATTATTCAGG - Intergenic
985954461 5:3253126-3253148 GAGGGTAGAAACCATTTTTTAGG - Intergenic
987385453 5:17324912-17324934 TAGGGCAAAAGGGATTTTTCAGG + Intergenic
988026802 5:25704913-25704935 AAGGATGGAAAAGATTTATCAGG - Intergenic
988143592 5:27274923-27274945 TATGTTAGAAAAGATTTTAAAGG - Intergenic
988261939 5:28898047-28898069 TAGAATAGAAATGATTTTCCAGG - Intergenic
988928138 5:36009610-36009632 TAGAGAAGAAAAGATTTTCAGGG - Intergenic
989685233 5:44077958-44077980 TAAAATAGAAAATATTTTTCTGG - Intergenic
990271743 5:54149182-54149204 AATGATAGAAGAGATTTTTCAGG + Intronic
990517072 5:56540234-56540256 CAGGGTAATAAACATTTTTCAGG + Intronic
991153124 5:63395880-63395902 CAGGATAGATAATATTTTTCTGG + Intergenic
991439850 5:66635460-66635482 TATCCTAGAAAACATTTTTCTGG - Intronic
991479860 5:67066535-67066557 TAGGGGAAAAAAGATATTTAAGG - Intronic
991522985 5:67521354-67521376 TATAGTAGAAAATATTTTACAGG + Intergenic
991919583 5:71642322-71642344 GAGGGAAGGACAGATTTTTCTGG + Intronic
992653940 5:78889833-78889855 TGGGGTAGAGATGATGTTTCAGG - Intronic
993697819 5:91082660-91082682 GAGAGTAGAAAAAATTTTTGAGG + Intronic
994724719 5:103420983-103421005 TTGGGTAGAATAGATTCTCCTGG - Intergenic
994805005 5:104434245-104434267 TAGGTAAGAAAAGAATATTCCGG - Intergenic
996405701 5:123100091-123100113 TAGCGGAGAATAGATTTCTCTGG + Intronic
996941777 5:129015588-129015610 TAAGGAAGAAAGCATTTTTCAGG - Intronic
997668224 5:135649243-135649265 TAGGGTGGAAAAGAGTTCTGTGG + Intergenic
1000138047 5:158372471-158372493 AAAGGTAGAAAAAATATTTCAGG - Intergenic
1000797761 5:165686730-165686752 AAGAGTAGAAAAGATTATTAAGG - Intergenic
1001379339 5:171293264-171293286 TAGGGGAGATAAGATTATACAGG - Intronic
1003477581 6:6498351-6498373 AGGGGTGGGAAAGATTTTTCTGG - Intergenic
1003843809 6:10151171-10151193 AAGGGTGGATACGATTTTTCAGG - Intronic
1004950939 6:20671218-20671240 TAGGGAAGAAATGGTATTTCAGG + Intronic
1005643236 6:27816601-27816623 TATGTTAGAAAGTATTTTTCAGG - Intergenic
1005942877 6:30574117-30574139 TAAAGTACAAAAGATTTTTTTGG + Intronic
1006822991 6:36913390-36913412 GAGGGTAGACAGGACTTTTCTGG - Intronic
1007833297 6:44655383-44655405 TAAGGTAGATAAGAGTTTTGGGG - Intergenic
1009359719 6:62796463-62796485 TAGGGAAGACAAGTTTTTTGGGG - Intergenic
1010117248 6:72328462-72328484 TGGGGTACATAAGATTTTTTGGG - Intronic
1013718791 6:112997525-112997547 TAGTGCAGAAAAGAAATTTCAGG - Intergenic
1014125442 6:117771740-117771762 TAGGTTACAAAAGATTATTTTGG - Intergenic
1015072203 6:129107878-129107900 TAGGGCAGAGCAGATTTTCCAGG - Intronic
1015345561 6:132153544-132153566 AAATGAAGAAAAGATTTTTCAGG - Intergenic
1015737758 6:136419072-136419094 AAGGGTGGAAGAGATTTTTCTGG + Intronic
1016044642 6:139468233-139468255 TATGGTAGAAAACCTTTCTCAGG + Intergenic
1016395437 6:143618817-143618839 AGGGGTAGAAGAGAGTTTTCGGG - Intronic
1017389862 6:153926195-153926217 TAGGGATGACAAGTTTTTTCGGG - Intergenic
1018495038 6:164339733-164339755 TAGGGAAGACAAGTTTTTTTGGG + Intergenic
1018605897 6:165597489-165597511 TAAGGGAGAAAACATTTTTGTGG - Intronic
1020614694 7:10443536-10443558 AAGGGTAGAGTAGATTTCTCAGG + Intergenic
1021122891 7:16816755-16816777 CAGTGTAGAAGATATTTTTCGGG + Intronic
1021174727 7:17437984-17438006 TAGGCTACATGAGATTTTTCTGG - Intergenic
1022873359 7:34502707-34502729 TAAGCTAGAAAAGAGCTTTCTGG + Intergenic
1023326646 7:39067886-39067908 TAGGTTAGAAAAAAATTTTAAGG + Intronic
1026211676 7:68311461-68311483 TAGAGAAGAAAAGATTTGGCCGG + Intergenic
1028690524 7:93644569-93644591 TAGGGAAGACAAGTTTTTTGGGG - Intronic
1028697394 7:93731016-93731038 TAGGGTTTAAATAATTTTTCAGG + Intronic
1033811960 7:145024946-145024968 ATGGAAAGAAAAGATTTTTCTGG - Intergenic
1037274776 8:17166144-17166166 TAGATTTGAAAAGATCTTTCTGG + Intronic
1042035421 8:64527816-64527838 TGGGTTACAAAAGATTTTTTTGG + Intergenic
1042435077 8:68754822-68754844 TGAGGTAGAACAAATTTTTCAGG + Intronic
1042516814 8:69667747-69667769 AAAGGTAGAAAAAATATTTCAGG - Exonic
1043019905 8:74987236-74987258 TAGGGTAAAATAATTTTTTCTGG - Intronic
1043261619 8:78206868-78206890 AAGGGCAGAAAAGATTTTAAGGG - Intergenic
1043518230 8:81016552-81016574 AAGGGTAGAAAATATATTTCAGG - Intronic
1043786629 8:84409876-84409898 TAGAATATAAAAGAGTTTTCTGG - Intronic
1044199892 8:89421803-89421825 TAGGGCAGAACATATGTTTCAGG + Intergenic
1046151986 8:110239557-110239579 TAGGGAGGAACAGATTTTTTGGG + Intergenic
1046157515 8:110312450-110312472 TAGGGGAAAAAAGAGTTTTATGG + Intergenic
1047456926 8:125023400-125023422 AAGGGAAGAAAAGACTTTACAGG - Intergenic
1047651411 8:126926632-126926654 TAGGTAAAAAAAGATTTTTAAGG - Intergenic
1051755129 9:20391176-20391198 TTGGGTAGAAAAAAATTTTAAGG + Intronic
1052002552 9:23303919-23303941 TAGAGTAGGAAATATATTTCAGG - Intergenic
1052763176 9:32613289-32613311 AAGAGTAGAAAATATCTTTCTGG - Intergenic
1055352202 9:75401158-75401180 TAGGATAGAAAAGACATCTCTGG - Intergenic
1055370334 9:75591702-75591724 AAACGTGGAAAAGATTTTTCTGG - Intergenic
1055620199 9:78117541-78117563 TAAGGTAGAATCAATTTTTCAGG - Intergenic
1055821032 9:80264489-80264511 TGGAATTGAAAAGATTTTTCTGG - Intergenic
1057361509 9:94377679-94377701 TAAGGTAGAAAAAAGTTGTCAGG - Intronic
1057661851 9:97010494-97010516 TAAGGTAGAAAAAAGTTGTCAGG + Intronic
1059706803 9:116831774-116831796 AAGTATAGACAAGATTTTTCTGG - Intronic
1059783577 9:117555874-117555896 TATGGTAGAAAACATTTTTGTGG - Intergenic
1060444269 9:123673462-123673484 TTTGGCAGAAAAGATATTTCAGG + Intronic
1060670007 9:125460328-125460350 TAGAGTAGAAAACATTTTGAGGG - Intronic
1185906811 X:3941484-3941506 TGGTATAGAAAAGATTTTTTAGG - Intergenic
1186971991 X:14856663-14856685 TAGGGTTGGAAAACTTTTTCTGG - Intronic
1190488354 X:50954414-50954436 TAGTTAAGAAAAGATTCTTCTGG + Intergenic
1191609794 X:63100692-63100714 AAGTATAGAAAAGAATTTTCTGG + Intergenic
1194645902 X:96457786-96457808 TAAGGTGTAAAAGAATTTTCAGG + Intergenic
1194822416 X:98525257-98525279 TAGGGATGACAAGATTTTTGGGG + Intergenic
1194938919 X:99985897-99985919 TAGGGTAGACAAGAATGTTTTGG + Intergenic
1195684453 X:107572927-107572949 TAAAGTAGAAAAGAATCTTCAGG + Intronic
1195691705 X:107631582-107631604 AAGGGTAGATACCATTTTTCAGG + Intronic
1195900238 X:109789938-109789960 TATGGTAGAAAAGATGATTCAGG + Intergenic
1197349620 X:125367941-125367963 TCAGGGAGAAAAGATTTTTAGGG + Intergenic
1199689529 X:150297782-150297804 GAGGGAAGATAATATTTTTCAGG - Intergenic
1202607025 Y:26647914-26647936 TAGGGTGGAAAAGAATTTAATGG + Intergenic