ID: 1075608689

View in Genome Browser
Species Human (GRCh38)
Location 10:123834649-123834671
Sequence CAGTCTCCATAGGCCCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075608682_1075608689 17 Left 1075608682 10:123834609-123834631 CCATGAGCGAAGGGAATGACATC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1075608689 10:123834649-123834671 CAGTCTCCATAGGCCCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075608689 Original CRISPR CAGTCTCCATAGGCCCTTGT GGG Intronic
No off target data available for this crispr