ID: 1075618160

View in Genome Browser
Species Human (GRCh38)
Location 10:123906280-123906302
Sequence ATGTCTACCTAGAAGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075618158_1075618160 10 Left 1075618158 10:123906247-123906269 CCTCTGTGTCCTGATCTATAAAA 0: 1
1: 3
2: 95
3: 993
4: 5122
Right 1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG No data
1075618159_1075618160 1 Left 1075618159 10:123906256-123906278 CCTGATCTATAAAATGAGACACT 0: 1
1: 0
2: 8
3: 79
4: 856
Right 1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG No data
1075618157_1075618160 20 Left 1075618157 10:123906237-123906259 CCTTACTGAGCCTCTGTGTCCTG 0: 1
1: 0
2: 3
3: 88
4: 782
Right 1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075618160 Original CRISPR ATGTCTACCTAGAAGAGAGA TGG Intronic
No off target data available for this crispr