ID: 1075623043

View in Genome Browser
Species Human (GRCh38)
Location 10:123941683-123941705
Sequence AGCCGTCCGCTGCAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075623043_1075623057 23 Left 1075623043 10:123941683-123941705 CCTCCCACCTGCAGCGGACGGCT No data
Right 1075623057 10:123941729-123941751 TCCCCCTCCTCTGCCTTTGGGGG No data
1075623043_1075623054 20 Left 1075623043 10:123941683-123941705 CCTCCCACCTGCAGCGGACGGCT No data
Right 1075623054 10:123941726-123941748 CTTTCCCCCTCCTCTGCCTTTGG No data
1075623043_1075623048 -4 Left 1075623043 10:123941683-123941705 CCTCCCACCTGCAGCGGACGGCT No data
Right 1075623048 10:123941702-123941724 GGCTGCCCTGTGGACCCCAGAGG No data
1075623043_1075623056 22 Left 1075623043 10:123941683-123941705 CCTCCCACCTGCAGCGGACGGCT No data
Right 1075623056 10:123941728-123941750 TTCCCCCTCCTCTGCCTTTGGGG No data
1075623043_1075623055 21 Left 1075623043 10:123941683-123941705 CCTCCCACCTGCAGCGGACGGCT No data
Right 1075623055 10:123941727-123941749 TTTCCCCCTCCTCTGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075623043 Original CRISPR AGCCGTCCGCTGCAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr