ID: 1075623618

View in Genome Browser
Species Human (GRCh38)
Location 10:123946268-123946290
Sequence GGTCCCAAGGGACTACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075623612_1075623618 -5 Left 1075623612 10:123946250-123946272 CCAGGAGGAGGGACCCTGGGTCC No data
Right 1075623618 10:123946268-123946290 GGTCCCAAGGGACTACATGGAGG No data
1075623605_1075623618 12 Left 1075623605 10:123946233-123946255 CCAGACCATGATGGAGACCAGGA No data
Right 1075623618 10:123946268-123946290 GGTCCCAAGGGACTACATGGAGG No data
1075623602_1075623618 24 Left 1075623602 10:123946221-123946243 CCTTCATGTTAACCAGACCATGA No data
Right 1075623618 10:123946268-123946290 GGTCCCAAGGGACTACATGGAGG No data
1075623607_1075623618 7 Left 1075623607 10:123946238-123946260 CCATGATGGAGACCAGGAGGAGG No data
Right 1075623618 10:123946268-123946290 GGTCCCAAGGGACTACATGGAGG No data
1075623600_1075623618 30 Left 1075623600 10:123946215-123946237 CCCTTTCCTTCATGTTAACCAGA No data
Right 1075623618 10:123946268-123946290 GGTCCCAAGGGACTACATGGAGG No data
1075623601_1075623618 29 Left 1075623601 10:123946216-123946238 CCTTTCCTTCATGTTAACCAGAC No data
Right 1075623618 10:123946268-123946290 GGTCCCAAGGGACTACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075623618 Original CRISPR GGTCCCAAGGGACTACATGG AGG Intergenic
No off target data available for this crispr