ID: 1075623619

View in Genome Browser
Species Human (GRCh38)
Location 10:123946271-123946293
Sequence TCACCTCCATGTAGTCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075623619_1075623625 9 Left 1075623619 10:123946271-123946293 CCCAAGGGACTACATGGAGGTGA No data
Right 1075623625 10:123946303-123946325 AGGCCTGTCCTGCAAGCACGAGG No data
1075623619_1075623627 16 Left 1075623619 10:123946271-123946293 CCCAAGGGACTACATGGAGGTGA No data
Right 1075623627 10:123946310-123946332 TCCTGCAAGCACGAGGTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075623619 Original CRISPR TCACCTCCATGTAGTCCCTT GGG (reversed) Intergenic