ID: 1075623627

View in Genome Browser
Species Human (GRCh38)
Location 10:123946310-123946332
Sequence TCCTGCAAGCACGAGGTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075623616_1075623627 23 Left 1075623616 10:123946264-123946286 CCTGGGTCCCAAGGGACTACATG No data
Right 1075623627 10:123946310-123946332 TCCTGCAAGCACGAGGTGCGCGG No data
1075623620_1075623627 15 Left 1075623620 10:123946272-123946294 CCAAGGGACTACATGGAGGTGAG No data
Right 1075623627 10:123946310-123946332 TCCTGCAAGCACGAGGTGCGCGG No data
1075623619_1075623627 16 Left 1075623619 10:123946271-123946293 CCCAAGGGACTACATGGAGGTGA No data
Right 1075623627 10:123946310-123946332 TCCTGCAAGCACGAGGTGCGCGG No data
1075623615_1075623627 24 Left 1075623615 10:123946263-123946285 CCCTGGGTCCCAAGGGACTACAT No data
Right 1075623627 10:123946310-123946332 TCCTGCAAGCACGAGGTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075623627 Original CRISPR TCCTGCAAGCACGAGGTGCG CGG Intergenic