ID: 1075629478

View in Genome Browser
Species Human (GRCh38)
Location 10:123992310-123992332
Sequence GTGGGGCAACTGAGGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075629478_1075629500 30 Left 1075629478 10:123992310-123992332 CCGGCCTCCCTCAGTTGCCCCAC No data
Right 1075629500 10:123992363-123992385 GGACAGAACCTGGCGGCGAAGGG 0: 1
1: 0
2: 2
3: 2
4: 89
1075629478_1075629490 6 Left 1075629478 10:123992310-123992332 CCGGCCTCCCTCAGTTGCCCCAC No data
Right 1075629490 10:123992339-123992361 TGGTGGCAGAGATCCCCTCTCGG 0: 1
1: 0
2: 1
3: 25
4: 124
1075629478_1075629492 8 Left 1075629478 10:123992310-123992332 CCGGCCTCCCTCAGTTGCCCCAC No data
Right 1075629492 10:123992341-123992363 GTGGCAGAGATCCCCTCTCGGGG 0: 1
1: 0
2: 1
3: 6
4: 93
1075629478_1075629496 20 Left 1075629478 10:123992310-123992332 CCGGCCTCCCTCAGTTGCCCCAC No data
Right 1075629496 10:123992353-123992375 CCCTCTCGGGGGACAGAACCTGG 0: 1
1: 0
2: 1
3: 14
4: 198
1075629478_1075629499 29 Left 1075629478 10:123992310-123992332 CCGGCCTCCCTCAGTTGCCCCAC No data
Right 1075629499 10:123992362-123992384 GGGACAGAACCTGGCGGCGAAGG 0: 1
1: 0
2: 1
3: 14
4: 129
1075629478_1075629491 7 Left 1075629478 10:123992310-123992332 CCGGCCTCCCTCAGTTGCCCCAC No data
Right 1075629491 10:123992340-123992362 GGTGGCAGAGATCCCCTCTCGGG 0: 1
1: 0
2: 1
3: 18
4: 281
1075629478_1075629498 23 Left 1075629478 10:123992310-123992332 CCGGCCTCCCTCAGTTGCCCCAC No data
Right 1075629498 10:123992356-123992378 TCTCGGGGGACAGAACCTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1075629478_1075629493 9 Left 1075629478 10:123992310-123992332 CCGGCCTCCCTCAGTTGCCCCAC No data
Right 1075629493 10:123992342-123992364 TGGCAGAGATCCCCTCTCGGGGG 0: 1
1: 0
2: 1
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075629478 Original CRISPR GTGGGGCAACTGAGGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr