ID: 1075629532

View in Genome Browser
Species Human (GRCh38)
Location 10:123992474-123992496
Sequence CTCTATAGGCTGCTGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075629532_1075629538 -10 Left 1075629532 10:123992474-123992496 CCAACCAGCAGCAGCCTATAGAG No data
Right 1075629538 10:123992487-123992509 GCCTATAGAGGGCACTGATGGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1075629532_1075629540 16 Left 1075629532 10:123992474-123992496 CCAACCAGCAGCAGCCTATAGAG No data
Right 1075629540 10:123992513-123992535 AACCAAACAGACAGCCCCATTGG 0: 1
1: 0
2: 2
3: 9
4: 140
1075629532_1075629544 21 Left 1075629532 10:123992474-123992496 CCAACCAGCAGCAGCCTATAGAG No data
Right 1075629544 10:123992518-123992540 AACAGACAGCCCCATTGGAGGGG 0: 1
1: 1
2: 0
3: 8
4: 142
1075629532_1075629542 19 Left 1075629532 10:123992474-123992496 CCAACCAGCAGCAGCCTATAGAG No data
Right 1075629542 10:123992516-123992538 CAAACAGACAGCCCCATTGGAGG 0: 1
1: 1
2: 2
3: 14
4: 184
1075629532_1075629543 20 Left 1075629532 10:123992474-123992496 CCAACCAGCAGCAGCCTATAGAG No data
Right 1075629543 10:123992517-123992539 AAACAGACAGCCCCATTGGAGGG 0: 1
1: 2
2: 0
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075629532 Original CRISPR CTCTATAGGCTGCTGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr