ID: 1075631214

View in Genome Browser
Species Human (GRCh38)
Location 10:124001673-124001695
Sequence GAGCAGGACGGCCGGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075631207_1075631214 0 Left 1075631207 10:124001650-124001672 CCTTCCCGCAGAAGAGATGGCAG No data
Right 1075631214 10:124001673-124001695 GAGCAGGACGGCCGGCAAGATGG No data
1075631205_1075631214 26 Left 1075631205 10:124001624-124001646 CCTGAAGGAGGAAGCTGGGGGCA No data
Right 1075631214 10:124001673-124001695 GAGCAGGACGGCCGGCAAGATGG No data
1075631210_1075631214 -5 Left 1075631210 10:124001655-124001677 CCGCAGAAGAGATGGCAGGAGCA No data
Right 1075631214 10:124001673-124001695 GAGCAGGACGGCCGGCAAGATGG No data
1075631209_1075631214 -4 Left 1075631209 10:124001654-124001676 CCCGCAGAAGAGATGGCAGGAGC No data
Right 1075631214 10:124001673-124001695 GAGCAGGACGGCCGGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075631214 Original CRISPR GAGCAGGACGGCCGGCAAGA TGG Intergenic
No off target data available for this crispr