ID: 1075632364

View in Genome Browser
Species Human (GRCh38)
Location 10:124008464-124008486
Sequence GTCCCCACCTTCTCTATAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075632364_1075632366 -7 Left 1075632364 10:124008464-124008486 CCGGCTATAGAGAAGGTGGGGAC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1075632366 10:124008480-124008502 TGGGGACTGTCCCTGCAAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 127
1075632364_1075632367 1 Left 1075632364 10:124008464-124008486 CCGGCTATAGAGAAGGTGGGGAC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1075632367 10:124008488-124008510 GTCCCTGCAAGTGGGAGTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 174
1075632364_1075632365 -8 Left 1075632364 10:124008464-124008486 CCGGCTATAGAGAAGGTGGGGAC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1075632365 10:124008479-124008501 GTGGGGACTGTCCCTGCAAGTGG 0: 1
1: 0
2: 0
3: 20
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075632364 Original CRISPR GTCCCCACCTTCTCTATAGC CGG (reversed) Exonic
901776034 1:11561000-11561022 CTCCCCACCTGCTCTGGAGCAGG - Intergenic
904858511 1:33517908-33517930 GTCCCCACCATCTCTGTTGGTGG + Intronic
909629866 1:77759872-77759894 GCCCCCACCTCCCCTATCGCCGG - Intergenic
920522218 1:206635923-206635945 GCCCCCACCTCCTCTCTATCAGG + Intronic
921131739 1:212225618-212225640 GTCCCCACATTCTGCATAACGGG + Intergenic
921273584 1:213494135-213494157 GTCCCAACCATTTCTGTAGCCGG - Intergenic
921432890 1:215083414-215083436 CTCACCTCCTGCTCTATAGCCGG - Exonic
922895022 1:229093213-229093235 GGTCCCAACTTCTCTATTGCTGG + Intergenic
923255416 1:232217670-232217692 CACCCCATCTTCACTATAGCAGG + Intergenic
1071487247 10:86110469-86110491 GTGCCCTCCTTCTCAATAGGTGG - Intronic
1073831598 10:107390098-107390120 GTTCCATTCTTCTCTATAGCAGG - Intergenic
1075609044 10:123836753-123836775 CTCCCCACCTTAACTATATCAGG + Intronic
1075632364 10:124008464-124008486 GTCCCCACCTTCTCTATAGCCGG - Exonic
1075634084 10:124018595-124018617 GTCCCCTCCTCCTCTGAAGCTGG - Intronic
1076409674 10:130236995-130237017 GTCCCCACCTTCCCTGTAAAGGG + Intergenic
1079023130 11:16925113-16925135 GTCCCCACCCTCTCCACTGCTGG + Intronic
1083417116 11:62533089-62533111 GTCCCCAAGTTCTCTGTATCAGG - Exonic
1086343004 11:85866536-85866558 GTCTCCACCTCCTAAATAGCAGG - Intronic
1086644507 11:89203326-89203348 GTCCCCAGCTTTACTTTAGCAGG - Intronic
1097008632 12:55936794-55936816 CTACCCACCTTCGCTATACCTGG + Intronic
1103003953 12:117407051-117407073 GTGCGCACCTTCTCTGTGGCAGG - Intronic
1104770198 12:131356735-131356757 GTCCCGACCTTCCCTATCGAAGG + Intergenic
1105969725 13:25417270-25417292 GTCCCCACCTTCTACAAAGCTGG + Intronic
1107682483 13:42866092-42866114 GCCCCCACTTTGTCTAGAGCTGG + Intergenic
1108701966 13:52951317-52951339 CTCCCCAACTTCTCTAGAGAAGG - Intergenic
1113421004 13:110171371-110171393 ATCCCCACATTCTAGATAGCAGG - Intronic
1117540887 14:56745612-56745634 TTGCCCACCTTCTCTGTAGCTGG + Intergenic
1121341762 14:93109627-93109649 GTCCCCACCTACTTTATGGATGG - Intronic
1121523504 14:94602391-94602413 GGCCCCACCTTCTCTGTGGAAGG - Intronic
1129614126 15:77084421-77084443 GTCCCGTCCATCTCTAAAGCGGG + Intergenic
1133689323 16:8197952-8197974 GTCCCCACACTCAGTATAGCAGG - Intergenic
1134541760 16:15072680-15072702 GTCCTTACCCTCTCGATAGCTGG - Intronic
1146845308 17:36178615-36178637 GTCCCCACGTGCTGTAGAGCAGG - Intronic
1146873524 17:36390458-36390480 GTCCCCACGTGCTGTAGAGCAGG - Intronic
1146880882 17:36441546-36441568 GTCCCCACGTGCTGTAGAGCAGG - Intergenic
1147065865 17:37922415-37922437 GTCCCCACGTGCTGTAGAGCAGG + Intergenic
1147198878 17:38786103-38786125 GTCCCCACCACCTCACTAGCTGG - Intronic
1150766469 17:68006108-68006130 GTCCCCACCTACCCTGTAGCAGG + Intergenic
1156689763 18:39693491-39693513 CTCCTGACCTTCTCCATAGCTGG + Intergenic
1163186368 19:15641916-15641938 GTTCCCACATTCTCCATTGCTGG + Intronic
1164205244 19:23053090-23053112 GTCCCCACATTCTCTATGTTGGG + Intergenic
1164824400 19:31273806-31273828 GGCCCCATCTTCTCTGTGGCTGG - Intergenic
1167612317 19:50513470-50513492 GTCCCCACCTCCTCTCTCTCTGG - Intronic
1167612324 19:50513499-50513521 GTCCCCACCTCCTCTCTCTCTGG - Intronic
927669317 2:25055605-25055627 ATCCCCACTTTCTTTTTAGCTGG + Intronic
936415058 2:112299839-112299861 TTCGCCATCTTCTCTATAGAAGG - Exonic
937047489 2:118859371-118859393 GTCACCTCCTTCTCTCTAGCAGG - Intergenic
937978594 2:127597070-127597092 GTCCCCTCATTCTCTATTCCCGG - Intronic
940918414 2:159283224-159283246 GTCCCCACCTTTTCGGCAGCAGG + Intronic
946364910 2:219243072-219243094 GTCCCGACCTTCTTTATAAGGGG + Intronic
946498713 2:220222627-220222649 GTCCCAACCTTCTGAGTAGCTGG + Intergenic
1173252071 20:41369089-41369111 GCCCCCACCTCCTCTGTAGCTGG + Intergenic
1176126669 20:63478607-63478629 CTCCCCACCTTCTCTGGAGCTGG + Intergenic
1181023838 22:20116793-20116815 GTCCCCACCTATTCTCTGGCAGG + Intronic
1183396756 22:37576048-37576070 AACCCCACTTTCTCTAAAGCAGG - Intronic
956905080 3:73757437-73757459 GTCTACACCTTCTTTAAAGCTGG - Intergenic
957292736 3:78297632-78297654 AGCCATACCTTCTCTATAGCAGG - Intergenic
958877171 3:99629716-99629738 TTCCCCACTCTCTCTGTAGCTGG - Intergenic
967323328 3:188215189-188215211 ATCCCCACCTTCTGAGTAGCTGG - Intronic
968237542 3:197044366-197044388 CTCCCCACGTTCTTAATAGCTGG + Exonic
981578036 4:146225461-146225483 GTCCCCACTGTCTCTGTACCTGG - Intronic
984587936 4:181584206-181584228 TTCCCCACCTCTTTTATAGCTGG - Intergenic
990878424 5:60513536-60513558 GTTCCCATTTTCTCTATAACTGG - Intronic
990937432 5:61165173-61165195 CTCCTCACCTTCTGAATAGCTGG + Intergenic
992530818 5:77650155-77650177 TTCCCAACCTTCCCTGTAGCTGG - Intergenic
997473504 5:134129782-134129804 GTCCCCACCTCCGCTGTGGCAGG + Intronic
998389742 5:141779843-141779865 GTCCCCACCCACTCTCTGGCAGG + Intergenic
1002178571 5:177417280-177417302 GCCCCCACTTCCTCTTTAGCAGG + Intronic
1014918220 6:127180166-127180188 TTCCTCTCCTTCTCTTTAGCTGG - Intronic
1017760199 6:157562553-157562575 GTCCCCTCCCTCTCTGTACCTGG - Intronic
1024426024 7:49227367-49227389 GTCTCCTCCTTCTCTCTGGCCGG + Intergenic
1025937711 7:66050548-66050570 GTCCCCACCTTTTCTGCAGGAGG + Intergenic
1027199206 7:76052319-76052341 CTCCCCACCTTAGCTGTAGCTGG - Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029108585 7:98198303-98198325 GCCTCCACCTCCTCAATAGCTGG + Intronic
1029794072 7:102875481-102875503 GTTCCAACTTTCTCTCTAGCTGG - Intronic
1031061693 7:117059036-117059058 GTCCCCACCTTCCCAATCTCTGG - Intronic
1032780981 7:135165108-135165130 GGCCCCACCTCCTCTGTAGTGGG - Exonic
1040505052 8:48039838-48039860 ATCCCCACCTTCTGAATAGCTGG + Intronic
1047219111 8:122904377-122904399 GTCTCCCCCTTCTTTACAGCAGG + Intronic
1047701639 8:127455032-127455054 ATCCCCACCTTCTGAGTAGCTGG - Intergenic
1048071502 8:131026505-131026527 GACCCCACCTTCTCTTCAGTGGG - Intronic
1051707287 9:19893901-19893923 GTCACCACCTACTCTCTAGTAGG + Intergenic
1052730580 9:32280513-32280535 CTCCCTACCTTCTCTTTAGCAGG + Intergenic
1057428960 9:94977239-94977261 GTCCCCACCTTATCTGCTGCTGG + Intronic
1058223100 9:102326441-102326463 GTACCCACATTCTATATAGAAGG + Intergenic
1058424646 9:104865846-104865868 GTCCCCATCTTTTCTATAAATGG - Intronic
1060549930 9:124480103-124480125 GTCCCCAGCTCCTATCTAGCTGG + Intergenic
1188951538 X:36381224-36381246 TTCCCCACCTTCTGTATAAAGGG + Intronic
1190398753 X:50010819-50010841 GTACCTACCTACTCTATTGCAGG + Intronic
1190581596 X:51896343-51896365 GTCCTCACCTTATCTATTCCAGG - Intronic
1191109618 X:56794448-56794470 GTACCCACCTCACCTATAGCAGG + Intergenic
1198065976 X:133097210-133097232 ACTCCCACCTTCTCTATAACAGG + Intergenic
1198986716 X:142463155-142463177 GTCCCAACCTCCTGAATAGCTGG + Intergenic