ID: 1075634521

View in Genome Browser
Species Human (GRCh38)
Location 10:124021216-124021238
Sequence AGGGGCCAGCTCGGGGGGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075634507_1075634521 23 Left 1075634507 10:124021170-124021192 CCCACAATGCCGCTTGCATAATA 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1075634521 10:124021216-124021238 AGGGGCCAGCTCGGGGGGTACGG 0: 1
1: 1
2: 2
3: 12
4: 235
1075634509_1075634521 14 Left 1075634509 10:124021179-124021201 CCGCTTGCATAATAACAACAAAC 0: 1
1: 0
2: 9
3: 12
4: 229
Right 1075634521 10:124021216-124021238 AGGGGCCAGCTCGGGGGGTACGG 0: 1
1: 1
2: 2
3: 12
4: 235
1075634513_1075634521 -8 Left 1075634513 10:124021201-124021223 CCAGCTCCTTCTGCCAGGGGCCA 0: 1
1: 0
2: 9
3: 49
4: 344
Right 1075634521 10:124021216-124021238 AGGGGCCAGCTCGGGGGGTACGG 0: 1
1: 1
2: 2
3: 12
4: 235
1075634508_1075634521 22 Left 1075634508 10:124021171-124021193 CCACAATGCCGCTTGCATAATAA 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1075634521 10:124021216-124021238 AGGGGCCAGCTCGGGGGGTACGG 0: 1
1: 1
2: 2
3: 12
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075634521 Original CRISPR AGGGGCCAGCTCGGGGGGTA CGG Intronic
900396639 1:2455753-2455775 AGGGCCCAGTTCGGGGAGTATGG + Intronic
900534179 1:3168921-3168943 AGGGGTCAGCTCAGGTGGGAGGG - Intronic
902384936 1:16071167-16071189 AGGGGCCAGGTGGGGGGCTCAGG + Intronic
902994264 1:20211585-20211607 AGGGGCCAGCTCTCTGTGTAGGG + Intergenic
903540730 1:24094808-24094830 AGGGGCCAGCTCTGGAGGCTGGG + Intronic
903929629 1:26854895-26854917 AGGGGGCAGCCCAGGGGATATGG - Exonic
904037199 1:27565238-27565260 AGGGGCCAGGCGGGGGAGTAGGG - Intronic
904044635 1:27602350-27602372 AGGGGCCAGCTGAGGGAGGAAGG - Intronic
910678616 1:89840497-89840519 AGTGGCCAGCTGTGGGGGAAGGG - Intronic
910703803 1:90105101-90105123 AGGGGCCAGCTCTGGCTGTGAGG - Intergenic
911060159 1:93740611-93740633 AGGGGCCAGCATGTGGGGTGAGG - Intronic
912626369 1:111207854-111207876 TGGGGGCAGCTCTAGGGGTAGGG - Intronic
912682404 1:111737916-111737938 AGGGGCCAGCTCTGGGGGTAGGG - Intronic
915562846 1:156697513-156697535 AGGGCCAAGGTCGGGGAGTAGGG - Intergenic
918087402 1:181257418-181257440 AGGCGCCAGCAAGGGAGGTAAGG + Intergenic
919743141 1:200992456-200992478 AGGGGCCAGCTCTGAGGGCATGG + Intronic
920401457 1:205679274-205679296 AGGGGCCAGAGTTGGGGGTAGGG - Intronic
923000603 1:230003834-230003856 GGGGGCCAGCTCTGGGGCTTGGG - Intergenic
1063339120 10:5245894-5245916 AGGCTCCACCTCTGGGGGTAGGG + Intergenic
1070351283 10:75594217-75594239 AGGGCCCAGCTCTGGGGGACCGG + Intronic
1070461454 10:76674524-76674546 ATGGGCCATCTCTGGGGGCAAGG - Intergenic
1071492239 10:86143828-86143850 AGGAGGCAGCTCGGGGTGCATGG + Intronic
1071526474 10:86362611-86362633 AGGGGCCAGCTCTGGGGGCAGGG - Intronic
1072717454 10:97761171-97761193 AGGGCCCAGCACTGGGGGTTGGG + Intergenic
1073147225 10:101288800-101288822 AGGGGCCAGCTTGGGGGTGTGGG - Intergenic
1074445944 10:113520911-113520933 AGGGGCCAGTGCGGGGGCTGGGG - Intergenic
1075634521 10:124021216-124021238 AGGGGCCAGCTCGGGGGGTACGG + Intronic
1075635691 10:124028904-124028926 AGGAGCCAGCTGGGGGGTTGGGG - Intronic
1076668370 10:132105422-132105444 AGGGGCAAGCCCGGGGGATGGGG + Intronic
1076676435 10:132149714-132149736 AGGGGTGAGGTGGGGGGGTAGGG - Intronic
1076792683 10:132785517-132785539 AGTGGCCCGCGCGGGGGGTGCGG - Intronic
1076984535 11:225776-225798 AGGGGCCAGATAGTGGGCTAGGG + Intronic
1077267765 11:1660639-1660661 AGGGGACAGCCGGGAGGGTAGGG + Intergenic
1077538349 11:3134995-3135017 AAGGCCCAGCTCGGGGGCTGGGG - Intronic
1077886330 11:6390541-6390563 AGGGTCCAGGCCGGGGGGGACGG + Exonic
1078601749 11:12738286-12738308 AGGGGTCAGCTCAGAAGGTACGG - Intronic
1078695615 11:13628689-13628711 AGGCTCCACCTCTGGGGGTAGGG - Intergenic
1081813636 11:45926882-45926904 AGAGGGCAGCCCAGGGGGTATGG + Intronic
1083769042 11:64856208-64856230 AGGGGGCAGCTCGGGGGAAGGGG - Intronic
1084000300 11:66292241-66292263 AGGGGCCCGCGTTGGGGGTAGGG + Intronic
1085039231 11:73317297-73317319 TGGGGCTACCTTGGGGGGTAGGG - Intronic
1085708650 11:78809627-78809649 AGCGGCCAGCTTGGGGTGGAAGG + Intronic
1087545907 11:99583409-99583431 AGGCTCCACCTCTGGGGGTAGGG - Intronic
1089384455 11:118058758-118058780 AGAGCCCAGCTCGGGGGGCCTGG + Intergenic
1089459599 11:118644826-118644848 AGAGGCCAGCTGGAGGGGTGAGG - Intronic
1090882556 11:130846697-130846719 AGGGGCCTGCTCTGAGGGTGTGG + Intergenic
1091340751 11:134811494-134811516 AGGGGCAAGCTTGGGGGAGAGGG + Intergenic
1093781886 12:23146385-23146407 AGGCGCCACCTCTGGGGGCAGGG + Intergenic
1094561220 12:31555635-31555657 AGGCGCCACCTCTGGGGGCAGGG - Intronic
1094779413 12:33773408-33773430 AGACGCCACCTCGGGGGGCAGGG + Intergenic
1094861893 12:34476846-34476868 AGGCTCCACCTCTGGGGGTAGGG + Intergenic
1095501387 12:42843268-42843290 TGGGGCCTGCTGGTGGGGTATGG - Intergenic
1095825516 12:46526436-46526458 AGGGGACAGAGCAGGGGGTAGGG - Intergenic
1096229584 12:49889620-49889642 AGGGGCCTGCTAGGAGGGTGGGG - Intronic
1101297086 12:103434928-103434950 AGGCTCCACCTCGGGGGGCAGGG + Intronic
1104493933 12:129219094-129219116 TGGGGCCAGCTCAGGTGATATGG + Intronic
1106619182 13:31357070-31357092 TGGGGGCAGCTGGGGGAGTAGGG + Intergenic
1108168060 13:47712687-47712709 AGGCTCCACCTCTGGGGGTAGGG + Intergenic
1108380617 13:49850647-49850669 ATGTGCCAGCTCTGGGGGTTTGG - Intergenic
1113938030 13:114005522-114005544 AGGGGACAGCCCTGGGGGTCTGG - Intronic
1114653084 14:24299182-24299204 TGGGGCGAGGTTGGGGGGTAGGG + Intronic
1117548609 14:56812235-56812257 AGGGGCCCGGGCGGGGGGGAGGG + Intergenic
1120570488 14:86110935-86110957 AGGATCCACCTCTGGGGGTAGGG - Intergenic
1122956659 14:105074492-105074514 AGGGGCCAGCTCTGGGGTTCAGG - Intergenic
1202916093 14_GL000194v1_random:174023-174045 AGGCTCCACCTCGGGGGGCAGGG - Intergenic
1124377482 15:29137463-29137485 AGGGGCCAGTTGGAGTGGTAGGG - Intronic
1124804237 15:32865120-32865142 AGGTGACAGCTAAGGGGGTAAGG + Intronic
1126600633 15:50424149-50424171 AGGGTGCAGTGCGGGGGGTAAGG + Intergenic
1128416738 15:67453808-67453830 AGGCGCCACCTCTGGGGGCAGGG - Intronic
1132838574 16:1967108-1967130 AGGGGGCAGCTGTGGGGGTTAGG - Intronic
1132844565 16:1993866-1993888 AGGGGCCATCTTGTGGGGCACGG - Exonic
1133212649 16:4272056-4272078 AGGGGCCCGCGCGGCCGGTAGGG - Intronic
1136403644 16:30031172-30031194 AGTGGCCAGCTTGGGGAGGACGG + Exonic
1141315732 16:82961100-82961122 TGGCGCCAGCTCAGGGGGTGTGG - Intronic
1142808474 17:2384359-2384381 AAGGGCCACCTCTGGGGGTTGGG + Exonic
1143242007 17:5451587-5451609 AGGGGCCAGCTGGGGAGGCTGGG + Intronic
1147578456 17:41615773-41615795 AGGAGGCAGCTTGGGGGCTAAGG + Intronic
1148097716 17:45064966-45064988 AGGGGCAAGCTGGGAGGTTAGGG - Intronic
1148105545 17:45116776-45116798 AGGGGACAGCTGTGGGGGGAAGG + Exonic
1148210637 17:45806528-45806550 AGAGGCCAGCTCTGGAGGAAGGG + Intronic
1148552929 17:48561329-48561351 AGGGGCCAGCTAGCTGGGTTGGG - Intronic
1148610161 17:48959780-48959802 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610172 17:48959820-48959842 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610191 17:48959900-48959922 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610202 17:48959940-48959962 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610213 17:48959980-48960002 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610224 17:48960020-48960042 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610244 17:48960100-48960122 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610255 17:48960140-48960162 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610266 17:48960180-48960202 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610285 17:48960260-48960282 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610304 17:48960340-48960362 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1148610331 17:48960460-48960482 TGGGCTCAGCTCGGTGGGTAGGG + Intronic
1150524355 17:65906255-65906277 AGGGGCCTGTCGGGGGGGTAGGG + Intronic
1152427784 17:80227895-80227917 AGGGGGCATCTCGGGGTGGACGG - Exonic
1152554001 17:81044093-81044115 AGGTGCCAGCCCGGGGGCTGTGG - Intronic
1152643469 17:81458531-81458553 AGGGGCCAGCGTGCGGGGGAGGG - Intronic
1155165811 18:23231588-23231610 AGGGACCAGTTCTGTGGGTAGGG + Intronic
1157592025 18:48841801-48841823 AGTGGCCATCTCGGGTGGGAGGG + Intronic
1158960467 18:62583868-62583890 AGGTGTCAGCTCGGGGTGGAGGG + Intronic
1159523392 18:69556230-69556252 AGGGGCCAGCGTGGAGGGCAGGG - Intronic
1161169116 19:2804261-2804283 AGGGGCCAGGTGGGAGGGTGTGG + Intronic
1161951510 19:7470377-7470399 AGGGGACAGCTGGGTGGGCATGG - Intronic
1162021565 19:7870550-7870572 AGGGGCCTGCACTGGGGGTGAGG + Exonic
1162567312 19:11451609-11451631 AGGGGCCAGGCCAGGGGGGAGGG - Exonic
1162964367 19:14149055-14149077 AGGGGCCACCTCTGGGGAAACGG + Exonic
1163026778 19:14517585-14517607 CGGGGCCGCCTCGGAGGGTAAGG - Intronic
1163767650 19:19172277-19172299 CTGGGCCAGCTCTGGGGGAAGGG + Intronic
1163822732 19:19505504-19505526 AGGGGCCAGGTGGGGGAGGAGGG - Exonic
1166299976 19:41907871-41907893 TGGGGCCAGCACAGGGGGTTTGG + Intronic
1166436840 19:42774551-42774573 AGGCTCCACCTCTGGGGGTAGGG - Intronic
1167476949 19:49706661-49706683 AGGGTCCAGCTCAGGGGTTTGGG - Intronic
1202670369 1_KI270709v1_random:44365-44387 AGGCTCCACCTCGGGGGGCAGGG + Intergenic
925413980 2:3656762-3656784 AGGAGCCAGCTCGGTGTGGAGGG + Intergenic
927672690 2:25082284-25082306 AGGAGCCAGCTAAGGGGGTTGGG + Intronic
928534334 2:32225652-32225674 AAGGGCCAGGTAGGTGGGTAGGG - Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
933727467 2:85434975-85434997 AGGGGACAGCTGCGGGGGTGGGG - Exonic
933969160 2:87456240-87456262 GGGGGCCAGCGCTGGGGGTGGGG + Intergenic
934651211 2:96092269-96092291 GGGGGCCAGCTCTGGGGGGTGGG - Intergenic
936045641 2:109185875-109185897 AGGGGCCAAGTCGGGTGGTGTGG + Intronic
936324631 2:111494268-111494290 GGGGGCCAGCGCTGGGGGTGGGG - Intergenic
937840021 2:126515437-126515459 AAGGGCAAGATCTGGGGGTAGGG + Intergenic
939509590 2:143089680-143089702 AGGAGCCCACTCGGGGGGTGTGG + Intergenic
941721482 2:168817385-168817407 AGGGGCTACCTCAGGGGGTGAGG + Intronic
942248032 2:174025328-174025350 ATAGGCCAGCTCCTGGGGTAAGG - Intergenic
942905336 2:181173631-181173653 ATGCCCCAGCTCTGGGGGTAGGG - Intergenic
946172833 2:217905626-217905648 AGGGGCCAGCACAGGGAGTACGG + Intronic
1170660408 20:18333455-18333477 AGGTTCCACCTCTGGGGGTAGGG + Intergenic
1171461010 20:25297899-25297921 AGTGGCCAACTAGGGGAGTATGG - Exonic
1172010242 20:31842274-31842296 AGGGTCCTGCTTGGGGGGTTGGG + Intergenic
1172568944 20:35954080-35954102 AGGCCGCAGCTCGGGGCGTAGGG + Exonic
1174399195 20:50266931-50266953 AGGGGACAGCTTGGGGGGTGGGG - Intergenic
1175985548 20:62762633-62762655 AGGGGCCGGCTCAGGGGCTCCGG - Exonic
1176231590 20:64035894-64035916 AGGGCCCAGCTGGTGGGGGAGGG - Intronic
1176269579 20:64228871-64228893 AGGGGCCGGCTCGGTCGGGACGG + Intronic
1176635445 21:9188669-9188691 AGGCTCCACCTCGGGGGGCAGGG - Intergenic
1179001435 21:37463535-37463557 AGGGGACTGCACGGGAGGTAAGG - Intronic
1179713329 21:43275312-43275334 AGGGCTCAGCTCGGGGTGGAGGG - Intergenic
1179963046 21:44781672-44781694 AGGGCCCTGCTCTGGGGGTGAGG - Intronic
1179984716 21:44913998-44914020 TGGGGCCAGCTCAGGGGCTGGGG - Intronic
1180004151 21:45012330-45012352 AGGGGGCAGCGCGGGGGCTGAGG - Intergenic
1180214284 21:46314785-46314807 GGGGGGCAGCTCTGGGGGCAGGG + Exonic
1180825021 22:18855948-18855970 AGGGGCCAGCTCTGGGCTGATGG + Intronic
1180964048 22:19776462-19776484 AGGGGCCTGCACGGGGTGGAGGG + Intronic
1181187710 22:21118600-21118622 AGGGGCCAGCTCTGGGCTGATGG - Intergenic
1181211488 22:21291893-21291915 AGGGGCCAGCTCTGGGCTGATGG + Intergenic
1181398015 22:22634994-22635016 AGGGGCCAGCTCTGGGCTGATGG - Intergenic
1181651392 22:24261066-24261088 AGGGGCCAGCTCTGGGCTGATGG + Intergenic
1181705986 22:24649673-24649695 AGGGGCCAGCTCTGGGCTGATGG - Intergenic
1184088853 22:42282115-42282137 AGGGACCAGCTCCAGGGGAAGGG + Intronic
1184388150 22:44187915-44187937 AGGGGCCAGGTCAGGGGGATGGG - Intronic
1185119057 22:48954924-48954946 AGGGCCCAGCTTGGGGGATGAGG - Intergenic
1185244000 22:49763709-49763731 AGGGGGCAGCTTGTGGGGTGCGG - Intergenic
1185296369 22:50057206-50057228 AGGGGTCAGCTCTGGGGTTGGGG + Intergenic
1203215460 22_KI270731v1_random:3538-3560 AGGGGCCAGCTCTGGGCTGATGG - Intergenic
1203275166 22_KI270734v1_random:81853-81875 AGGGGCCAGCTCTGGGCTGATGG + Intergenic
950538316 3:13594657-13594679 TGGGCCCAGGTCGGGGGCTAGGG - Intronic
951373891 3:21889295-21889317 AGGGGCCAGCTAGAAGGGCAAGG + Intronic
951720206 3:25689720-25689742 AGGGGCCAGGTAGGTGGGAAAGG + Intergenic
953495042 3:43378661-43378683 AGGGCCCTGCTCTGGGGGGAAGG - Intronic
953793345 3:45965076-45965098 AGGGGCCAGCTTGAGGAGCAAGG - Exonic
961392125 3:126558411-126558433 AGGGGTCAGGTGGGAGGGTATGG - Intronic
963119230 3:141762579-141762601 AGGCTCCAGCTCTGGGGGCAGGG - Intergenic
964532756 3:157685748-157685770 AGGCTCCACCTCTGGGGGTAGGG + Intergenic
966770792 3:183501610-183501632 AGGTGCCAGCCCTGGGGGTCAGG - Intronic
968622910 4:1611709-1611731 AGGGGCCAGCATGGAGGGTGAGG + Intergenic
968646807 4:1745251-1745273 AGTGGCCAGCTCTGAGGGGAAGG - Intergenic
968674845 4:1871698-1871720 AGGGGCCGGCTCAGGGGCTGGGG + Intronic
969295871 4:6270354-6270376 ACGGGGCAACTCGGGGGGGATGG - Intronic
972242948 4:37213679-37213701 AAGGGCCAGCTCTGGGAGAATGG - Intergenic
972377843 4:38489567-38489589 AGGAACTAGCTCGGGGGGCAGGG - Intergenic
972397820 4:38672628-38672650 AGGGGGCAGCTCGTGGGTAACGG + Intronic
972817062 4:42656662-42656684 TGGGGGCAGCGCGGGGGGAAGGG + Intronic
973569477 4:52223815-52223837 AGGCTCCACCTCTGGGGGTAGGG - Intergenic
973776223 4:54244117-54244139 AGGCTCCATCTCTGGGGGTAGGG + Intronic
973984422 4:56336823-56336845 AGGCGCCACCTCTGGGGGCAGGG - Intergenic
981165248 4:141549843-141549865 AGGCTCCACCTCTGGGGGTAGGG + Intergenic
981836868 4:149064741-149064763 AGGGCCCAGCGTGGGGGGTAGGG + Intergenic
985495081 5:199682-199704 TGGGGCCTCCTCGGGAGGTAGGG - Exonic
986359859 5:6966816-6966838 AGGCTCCAGCTCTGGGGGCAGGG + Intergenic
987088137 5:14488042-14488064 AGGGGGCTGCTGGGGGGGAAGGG - Exonic
989253671 5:39343581-39343603 AGAGTCCACCTCTGGGGGTAGGG + Intronic
989972486 5:50541617-50541639 AGGCGCCACCTCTGGGGGTAGGG + Intergenic
990179214 5:53141608-53141630 AGGCGCCACCTCTGGGGGCAGGG + Intergenic
991078188 5:62565782-62565804 CAGGGCCAGTTGGGGGGGTAGGG - Intronic
991241904 5:64470359-64470381 AGGCTCCACCTCAGGGGGTAGGG - Intergenic
991242719 5:64477636-64477658 AGGCTCCACCTCAGGGGGTAGGG + Intergenic
997356015 5:133263429-133263451 AGGGGCCAGTGAGGAGGGTAGGG + Intronic
998176706 5:139905668-139905690 AGGGGCCAGCTCTGGTGGGGGGG + Intronic
1001592535 5:172875454-172875476 AGAAGCCTGCTGGGGGGGTAGGG - Intronic
1002082163 5:176743577-176743599 AGGGGCCAGCCCCGGGGGTGCGG - Intergenic
1004074037 6:12329122-12329144 AAGGGACAGGTCAGGGGGTAGGG - Intergenic
1006215048 6:32434329-32434351 AGGGGCCTGTTGGGGGGGTGGGG + Intergenic
1006579996 6:35071680-35071702 TGTGGCCAGCTCAGGGGGTGTGG - Intronic
1007722909 6:43896013-43896035 AGTGGCCAGGTCGGGGGGTAAGG + Intergenic
1011214730 6:84993463-84993485 TGGGGCCTGTTCGGGGAGTAGGG + Intergenic
1014952873 6:127579030-127579052 AGGGGCCAGCTCTGGTAGTTAGG + Intronic
1017077520 6:150632541-150632563 AGAGGCCAGGTAGAGGGGTATGG - Intronic
1017633839 6:156424318-156424340 AGGGGCCAGCTCAGGGGCATTGG - Intergenic
1018452577 6:163922868-163922890 AGGGGTCAGTTGGGGGGGAATGG - Intergenic
1018729419 6:166637469-166637491 AGGTGCCAGGTCGGGGGAGAGGG + Intronic
1019288132 7:233934-233956 TGTGGCCAGCTCTGGGGGGAGGG + Intronic
1019719430 7:2559304-2559326 AGGGGCCGGCCCGGGGCGTGAGG + Intronic
1020645645 7:10811486-10811508 AGGCTCCACCTCTGGGGGTAGGG - Intergenic
1022345230 7:29508270-29508292 AGGGGGCAGGTCTGGGGGAAGGG + Intronic
1024044799 7:45579342-45579364 AGGGGCCAGCAGGGGAGGTAGGG - Intronic
1025184115 7:56843969-56843991 AGGCTCCACCTCTGGGGGTAGGG - Intergenic
1025658235 7:63539744-63539766 AGGCGCCACCTCTGGGGGCAGGG - Intergenic
1025687813 7:63732999-63733021 AGGCTCCACCTCTGGGGGTAGGG + Intergenic
1025993622 7:66514157-66514179 AGGGGTCAGCTCGGTGGCTTTGG - Intergenic
1026034799 7:66823279-66823301 AGGGGTCAGCTCGGTGGCTTTGG + Intergenic
1026771830 7:73206990-73207012 AGGTGCCAGCGCGGGGAGTGAGG + Intergenic
1027012698 7:74760386-74760408 AGGTGCCAGCGCGGGGAGTGAGG + Intronic
1027075342 7:75185667-75185689 AGGTGCCAGCGCGGGGAGTGAGG - Intergenic
1027978461 7:85186864-85186886 AGGGGCCAGGCCGGGAGGCAGGG + Intergenic
1029625542 7:101718303-101718325 GGGGGGCAGGTCGGGGAGTAGGG + Intergenic
1030495571 7:110295406-110295428 TGGGGCCTGCTGGGGGTGTAGGG - Intergenic
1031977524 7:128103587-128103609 AGGGGAGAGCTCGGTGGATAAGG - Intergenic
1032193931 7:129779357-129779379 AGGGGCCAGCTCCGGGGCCCCGG + Intergenic
1033153647 7:138937764-138937786 AGGAGCCAACTCGGGGTGGATGG + Intronic
1034264088 7:149773002-149773024 AGGTGACAGCCCCGGGGGTAGGG - Intronic
1036258134 8:7221332-7221354 AGGGGCCAGTGGTGGGGGTAGGG - Intergenic
1036310183 8:7679928-7679950 AGGGGCCAGTGGTGGGGGTAGGG - Intergenic
1037776139 8:21836929-21836951 TGGGGCCTGTTCGGGGGGTGGGG - Intergenic
1039784361 8:40819536-40819558 AGGGGGGAGCACGGGAGGTATGG + Intronic
1044079431 8:87865537-87865559 AATAGCCAGCTCTGGGGGTATGG - Intergenic
1045293463 8:100852864-100852886 AGGCTCCACCTCTGGGGGTAGGG + Intergenic
1045335720 8:101202597-101202619 AGGGGTCACCTTGGGGGTTATGG + Exonic
1047387867 8:124426326-124426348 AGTGTCCTGCTCGGGGGGCAGGG + Intergenic
1048217810 8:132512456-132512478 AGAGGCCAGCTCTGGGTGAAGGG - Intergenic
1049673284 8:143878987-143879009 AGGAGCCAGACCGGGGGGTGAGG - Intergenic
1050374131 9:4953291-4953313 AGGCTCCACCTCTGGGGGTAGGG - Intergenic
1053000337 9:34574224-34574246 AGGGGCCAGCTCGTGGGCTGGGG + Intronic
1058114666 9:101071213-101071235 AGGGGACAGCTCAGGGAGTAAGG + Intronic
1061663859 9:132148825-132148847 AGGGGCCAGGTCGGGGGGAGGGG - Intergenic
1062414689 9:136442350-136442372 AGGGGCCAGCTTGGGGGCAGTGG + Intronic
1062428864 9:136518112-136518134 AGGTGCCAGCACAGGGGGTGCGG - Intronic
1062450648 9:136614385-136614407 AGGGGCCGGGTCTGGGGGTGGGG - Intergenic
1062467293 9:136686933-136686955 CGGGGCCAGGGCGGGGGGTGGGG + Intronic
1062533809 9:137012968-137012990 GGGGGCCTGCTGGGGGGGCAGGG - Intronic
1062569694 9:137179387-137179409 AGGTGTCAGCTCGGGGAGGAAGG - Intronic
1062699347 9:137890895-137890917 AGGGGACAGTTCGGGAGGGATGG + Intronic
1203651810 Un_KI270751v1:132236-132258 AGGCTCCACCTCTGGGGGTAGGG - Intergenic
1190603028 X:52111668-52111690 AGGCTCCACCTCTGGGGGTAGGG + Intergenic
1191807215 X:65148082-65148104 AGGGGCCAGCCTGGAGGATAGGG + Intergenic
1192071275 X:67943077-67943099 AGGCTCCACCTCTGGGGGTAGGG + Intergenic
1193017859 X:76756117-76756139 AGGCTCCAGCTCTGGGGGCAGGG + Intergenic
1199708499 X:150451404-150451426 AGGGGCCAGCCCTGTGGGTGTGG + Intronic
1201072901 Y:10165661-10165683 AGGCTCCACCTCTGGGGGTAGGG - Intergenic
1202055557 Y:20826458-20826480 AGGCTCCAGCTCTGGGGGCAGGG - Intergenic