ID: 1075635053

View in Genome Browser
Species Human (GRCh38)
Location 10:124024960-124024982
Sequence TGGGCATCTTTGGTAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075635053_1075635058 2 Left 1075635053 10:124024960-124024982 CCAGTTTTTACCAAAGATGCCCA 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1075635058 10:124024985-124025007 GAACTACCCAAATTGTTTGGTGG No data
1075635053_1075635057 -1 Left 1075635053 10:124024960-124024982 CCAGTTTTTACCAAAGATGCCCA 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1075635057 10:124024982-124025004 ACAGAACTACCCAAATTGTTTGG No data
1075635053_1075635060 8 Left 1075635053 10:124024960-124024982 CCAGTTTTTACCAAAGATGCCCA 0: 1
1: 0
2: 1
3: 21
4: 247
Right 1075635060 10:124024991-124025013 CCCAAATTGTTTGGTGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075635053 Original CRISPR TGGGCATCTTTGGTAAAAAC TGG (reversed) Intronic
901409582 1:9072776-9072798 TTGGCATTTTTAGTAGAAACGGG - Intronic
902393012 1:16117000-16117022 TGGGGATCTAAGGGAAAAACAGG + Intergenic
904263911 1:29306878-29306900 TGGGCAGCTTTGGTGACAGCGGG + Intronic
904364955 1:30004639-30004661 AGGGCATCCTTGGTATACACAGG - Intergenic
904502325 1:30921327-30921349 TGATTATTTTTGGTAAAAACAGG - Intergenic
905841575 1:41184738-41184760 TCAGCATCTTTGGTGAAAAGTGG - Intronic
907215406 1:52859278-52859300 TTGGCATCTTTGTTGAAAATCGG + Intronic
909648324 1:77942226-77942248 AGGGCATCTTTGGAAAATAAAGG - Intronic
911923878 1:103802171-103802193 AGAGCATCATTGCTAAAAACTGG + Intergenic
912302062 1:108528310-108528332 TTGGCATTTTTTGTAAAGACAGG + Intergenic
915474114 1:156142754-156142776 TTGGCATTTTTGGTAGAGACGGG + Intergenic
915741404 1:158121281-158121303 TTGGCATTTTTGGTAGAGACAGG - Intergenic
915747042 1:158169807-158169829 TGTGCATTTTTGGAAAAAACTGG + Intergenic
916029721 1:160865112-160865134 TTTGCATTTTTAGTAAAAACGGG - Intergenic
916707544 1:167367358-167367380 TGGGGTTCTTTGGTAAATGCTGG - Intronic
917606205 1:176632680-176632702 AGAGCTTCTTTGGTAAAAACAGG + Intronic
917864151 1:179177290-179177312 GGGGCATCTTTGGAATAATCAGG - Intronic
918748722 1:188242533-188242555 TGAGCTTCTTTGGTAAAAACTGG + Intergenic
923069990 1:230554510-230554532 TGGTTATCTCTGGTAAAAATGGG - Intergenic
923211631 1:231808800-231808822 TGGGCATCCCAGGTAAAACCTGG + Intronic
923853466 1:237820990-237821012 AGGGCATCTCTGGAAAAAAAAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1065721504 10:28632284-28632306 TGTGTATTTTTGGTAAAGACAGG + Intergenic
1066561126 10:36671017-36671039 TGGGCATGTTTGAGACAAACTGG - Intergenic
1068296316 10:55076938-55076960 TTGGTATTTTTAGTAAAAACGGG + Intronic
1071127380 10:82351065-82351087 TGTGTATTTTTGGTAGAAACGGG + Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072090009 10:92118301-92118323 TTTGCATTTTTAGTAAAAACGGG + Intronic
1072776680 10:98203545-98203567 TGTGAGTCTTTGGTAAATACTGG + Intronic
1073229215 10:101953300-101953322 TTTGTATCTTTGGTAAAGACAGG + Intronic
1074278203 10:112024796-112024818 TGAGGATCTTAGGTAAAAACCGG - Intergenic
1075624843 10:123955048-123955070 TGATTATCTTTGGTAAAAATGGG - Intergenic
1075635053 10:124024960-124024982 TGGGCATCTTTGGTAAAAACTGG - Intronic
1076317244 10:129551167-129551189 GAGGTATCTTTAGTAAAAACAGG + Intronic
1076524330 10:131101871-131101893 TTGGCATTTTTAGTAAAGACAGG + Intronic
1076579935 10:131500527-131500549 TGGGCAGCTTCGGTAAATATAGG + Intergenic
1077386553 11:2271970-2271992 TGGTCACCTTCGGGAAAAACCGG - Intergenic
1078492656 11:11783761-11783783 TGGGCAGCTATGATAAAAGCGGG - Intergenic
1079790858 11:24737730-24737752 CTGACATCTTTTGTAAAAACAGG - Intronic
1080085756 11:28279725-28279747 TTTGCATCTTTGGTAGAGACGGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081083388 11:38770187-38770209 TTGGCATCCTTGCTAAAAATGGG + Intergenic
1082899049 11:58226211-58226233 TGGGCTTTTATGGTAAATACAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083950519 11:65953200-65953222 TTGGCATTTTTAGTAGAAACAGG + Intronic
1087863913 11:103199413-103199435 TGGAAATCTTTGGAGAAAACAGG - Exonic
1088354275 11:108925863-108925885 TGGGCAGCTTTGTTGAAGACTGG + Intronic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1089464482 11:118675872-118675894 TTGGCATTTTTGGTAGAGACAGG + Intronic
1089923652 11:122234282-122234304 GGGGCATATTTGGTGCAAACAGG - Intergenic
1090471074 11:126981748-126981770 AGGCCCTCTTTGGTAGAAACGGG - Intronic
1093852790 12:24061161-24061183 TGGGGATCTTTGGATAAAAAAGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1097036319 12:56126894-56126916 TAAGCAGCTTTGGTAAACACAGG + Exonic
1097853100 12:64433425-64433447 TGAACATCTGTTGTAAAAACGGG - Exonic
1098310431 12:69143371-69143393 GAGGCATTTTTGGTAAAAAGAGG + Intergenic
1098478335 12:70932300-70932322 TGTGTATCTTTTTTAAAAACAGG + Intergenic
1098817566 12:75187045-75187067 AGGGCATCTTTTTTAAAAAAAGG - Intronic
1100112957 12:91268112-91268134 TGAGCAATTTTGGTAGAAACTGG + Intergenic
1100179774 12:92072788-92072810 GGGGCATCTGTGCTACAAACTGG - Intronic
1100910762 12:99359698-99359720 TAGGCATATTTGGTCAAAATGGG - Intronic
1101191265 12:102335907-102335929 TGGACATCTTTGGTAATAATGGG + Intergenic
1102273903 12:111564822-111564844 GGGGCATTTCTGGTAAAGACTGG + Intronic
1103053736 12:117802475-117802497 TGGGCATCTTTGGGGAAAGGGGG + Intronic
1105034825 12:132911143-132911165 TTTGCATCTTTGGTAGAGACGGG + Intronic
1106583730 13:31039047-31039069 TGGGAAGATCTGGTAAAAACTGG + Intergenic
1106634388 13:31511542-31511564 TGGGGATCTATGATAAAAAAGGG + Intergenic
1107115105 13:36738385-36738407 TGGGCATGGTGGGTAAAAGCTGG + Intergenic
1108183577 13:47866081-47866103 TGGGCATCTTGGGTCAAGACAGG + Intergenic
1108416723 13:50205135-50205157 TGTGCATTTTTTGTAGAAACGGG + Intronic
1109845102 13:67978534-67978556 TGTGTATTTTTGGTAGAAACAGG - Intergenic
1110153227 13:72280870-72280892 TGGGCATCTTTAATAAATACAGG - Intergenic
1111588539 13:90312679-90312701 GGGGCACATTTGGGAAAAACTGG + Intergenic
1111864721 13:93754197-93754219 TTGACATATTAGGTAAAAACTGG - Intronic
1112812077 13:103230673-103230695 TGATTATCTTTGGTAAAAATAGG + Intergenic
1115250287 14:31338717-31338739 TTGGCATATGTGGGAAAAACAGG + Intronic
1117003123 14:51392115-51392137 TAGGTATCTCTGGTCAAAACAGG - Intergenic
1117701633 14:58419731-58419753 TGTGTATTTTTGGTAAAGACGGG - Intronic
1118294699 14:64558404-64558426 TGTCCATTTTTGGTAAAGACAGG - Intronic
1118929756 14:70230490-70230512 TGGTCATTATTAGTAAAAACAGG - Intergenic
1119017693 14:71076452-71076474 TTTGCATCTTTGGAAAAACCTGG - Intronic
1119068545 14:71556461-71556483 TGGACATCATTGGTAAATCCAGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119891347 14:78184831-78184853 GGGGCAGATTTGGTAAAAAGTGG + Intergenic
1120155134 14:81085131-81085153 TTTGCATTTTTAGTAAAAACAGG + Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122867994 14:104617933-104617955 TGGGCATCTGTGGGAGAAGCAGG - Intergenic
1122890822 14:104731487-104731509 TGGGCATCTTAGGTAAATGCAGG + Intronic
1123190553 14:106565386-106565408 TGGGTCTCTTTGTCAAAAACCGG - Intergenic
1123482506 15:20645878-20645900 TTGGCATCTTTAAAAAAAACTGG - Intergenic
1126208260 15:46070954-46070976 TGGCAATTTGTGGTAAAAACAGG + Intergenic
1126828605 15:52576029-52576051 TGGGCACCTTTGTCAAAAATGGG + Intergenic
1127287318 15:57543168-57543190 TGGCAATCTTTGGTAATCACTGG + Intronic
1131211822 15:90504158-90504180 TTTGTATCTTTGGTAGAAACAGG - Intergenic
1131783215 15:95882876-95882898 TGGGCATCTTTAGAAAAATCCGG - Intergenic
1131804545 15:96107698-96107720 TGGAGAACTTTGGGAAAAACTGG - Intergenic
1134818679 16:17227927-17227949 TGGGCAACTTGGGGAATAACAGG + Intronic
1135002186 16:18786191-18786213 TTTGTATCTTTGGTAAAGACGGG - Intronic
1135744345 16:25003404-25003426 TTGGCATTTTTAGTAGAAACAGG + Intronic
1142588559 17:989860-989882 TTTGCATTTTTGGTAAAGACAGG + Intergenic
1143208573 17:5165407-5165429 TGTGCATTTTTTGTAAAGACAGG - Intronic
1144202358 17:12953052-12953074 TGGGGATTTGTGGTAAAGACAGG + Intronic
1144617904 17:16793516-16793538 TGTGCATTTTTTGTAAAGACAGG - Intronic
1144894800 17:18522166-18522188 TGTGCATTTTTTGTAAAGACAGG + Intergenic
1146320954 17:31846013-31846035 TGGCCATCTTTGATAGAGACAGG - Intergenic
1148541970 17:48488109-48488131 TTTGCATGTTTAGTAAAAACGGG - Intergenic
1149768049 17:59296705-59296727 TTGGCATTTTTGGTAGAGACGGG + Intergenic
1149871703 17:60188150-60188172 TGTGCATTTTTTGTAAAGACAGG + Intronic
1150937837 17:69656821-69656843 TTGGCATCTTTGGAAAGATCAGG + Intergenic
1151087809 17:71401157-71401179 TTTGCATTTTTGGTAAAGACGGG + Intergenic
1152045728 17:77934153-77934175 TGGGAAGCTTTGGGAAAGACTGG - Intergenic
1153253542 18:3147930-3147952 TGGGCATCTTTGTCAAATCCAGG - Intronic
1153583347 18:6597556-6597578 TGTGCATCTTTGATAACAAACGG - Intergenic
1155886075 18:31210071-31210093 TGTGCATAATTGTTAAAAACTGG - Intergenic
1156258287 18:35420712-35420734 TTTGTATTTTTGGTAAAAACAGG - Intergenic
1157990542 18:52490716-52490738 TGGGCATCATTGGTAACATTTGG + Intronic
1162937825 19:13990324-13990346 AGGGGATCTTTGGGAAAAAGGGG + Intronic
1163814895 19:19458767-19458789 TGGACATCTTCGATAAACACTGG + Intronic
1164654157 19:29908762-29908784 TTGGTATTTTTAGTAAAAACTGG - Intergenic
1164764259 19:30751575-30751597 TGGGCATCTTTGGAAATCAAAGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166738492 19:45100121-45100143 TGGGGAGCTTTTGTAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168514972 19:57003583-57003605 TGGGCAGCTCTGCTGAAAACAGG - Intergenic
925560598 2:5189795-5189817 AGGGCAACTTGGGGAAAAACTGG - Intergenic
927907921 2:26875311-26875333 TGGGCATGTGGGGTGAAAACAGG + Intronic
928287867 2:30009012-30009034 AGAGCATCTTTGGGAACAACTGG - Intergenic
929821241 2:45275565-45275587 TGGGCTACTGTGGTATAAACTGG + Intergenic
930679914 2:54246136-54246158 TTGGCATCTTTGTCAAAAATGGG + Intronic
931232448 2:60386236-60386258 TTCCCATCTTTGGTAAAAAGTGG - Intergenic
937752490 2:125493605-125493627 TTGGCACCTTTGTCAAAAACTGG + Intergenic
938394679 2:130935207-130935229 TTGGTATTTTTGGTAGAAACAGG + Intronic
940651528 2:156445459-156445481 TCAGCATCATTGGTGAAAACTGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941993741 2:171581881-171581903 TTGGCATTTTTAGTAAAGACAGG + Intergenic
942445308 2:176073398-176073420 TGAGCAGCTTTGGCAATAACAGG - Intergenic
942988312 2:182167622-182167644 AGAGCATCTTTGGTACACACTGG + Intronic
943099414 2:183470715-183470737 TGGTTATCTTGGGTAAAATCTGG + Intergenic
943698931 2:190968525-190968547 TTGACATCTTTGGAAAAAAATGG + Intronic
943836144 2:192516301-192516323 TTGGCATCTTTGGTAGAATCAGG - Intergenic
945303474 2:208235885-208235907 TGGGAAACTTTGATAAAAAATGG - Intergenic
945913479 2:215677268-215677290 TGGGCCTTTTTGGGAAAAAAAGG - Intergenic
947246393 2:228053458-228053480 TGGGCATGTGTGTTAAAATCTGG + Intronic
1170409869 20:16077124-16077146 TGATTATCTTTGGTAAAAAATGG - Intergenic
1171496205 20:25557357-25557379 TGGGCATTTTTAGTAGAGACAGG - Intronic
1172347385 20:34213569-34213591 TGAACATCTGTTGTAAAAACGGG + Intronic
1172406788 20:34695740-34695762 TTGGCATTTTTAGTAGAAACGGG - Intergenic
1172486315 20:35299878-35299900 TGCGCATTCTTGGTAAAGACTGG - Intergenic
1174464928 20:50710035-50710057 TTGGTATCTTTAGTAAAGACAGG - Intergenic
1177464411 21:21457331-21457353 AGGGCATCATTGTTAAAAAGTGG + Intronic
1178244706 21:30939158-30939180 TGGGAGACTTTGGAAAAAACTGG + Intergenic
1178594766 21:33943172-33943194 TTTGCATTTTTGGTAAAGACAGG + Intergenic
1178602798 21:34009481-34009503 TGGGCATGTCTGGGAAGAACTGG + Intergenic
1182498845 22:30730999-30731021 TTTGCATCTTTAGTAAAGACAGG - Intronic
1182631445 22:31689047-31689069 TGGCCATCTTTGGAAGATACTGG - Intronic
1184914117 22:47556395-47556417 TTGGGATATTTGGTGAAAACTGG - Intergenic
950341497 3:12249805-12249827 TTGGCATCTTTGTCAAAAACCGG - Intergenic
951376574 3:21925351-21925373 TTTGCATCTTTGTTAAAAATTGG - Intronic
951419442 3:22466986-22467008 TGGCCATCTTTAGTCAAAAGGGG + Intergenic
955129026 3:56145283-56145305 TCGGCATCTTTGGCAAACACTGG + Intronic
956481010 3:69674054-69674076 TGGGCATATTTCGTAAAGAGTGG + Intergenic
956948254 3:74249352-74249374 TTTGTATTTTTGGTAAAAACAGG + Intergenic
957128829 3:76197908-76197930 TGGTCATCATAGGTAAAACCAGG - Intronic
958976860 3:100678715-100678737 TTGGCATCTTAGGTAAGATCTGG + Intronic
960477736 3:118150175-118150197 TGGTAATTTTTGTTAAAAACTGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963610201 3:147457413-147457435 TTTGCATTTTTGGTAAAGACTGG + Intronic
963855842 3:150252472-150252494 TGTGAAGCTTTTGTAAAAACTGG - Intergenic
964166491 3:153712838-153712860 TGGACAACTTAGGTAAAAATGGG - Intergenic
964400569 3:156293464-156293486 AGGGCAACTTTTATAAAAACAGG - Intronic
965890249 3:173504610-173504632 TGGAAATCTTGGGTATAAACAGG - Intronic
965931494 3:174048994-174049016 TCTGCATCTTTGGTAAAGATGGG + Intronic
966633036 3:182099687-182099709 TGTGTATTTTTGGTAAAGACGGG + Intergenic
966970587 3:185041899-185041921 TGGGCATGTTTGGGAAACAGTGG + Intronic
968527100 4:1065756-1065778 TTGGCATTTTTAGTAGAAACAGG + Intronic
969070648 4:4535617-4535639 GGAGCAGCTTTGGTAAAAGCTGG - Intronic
971150564 4:24027108-24027130 TTGGCATCCTTGGTAAAATAAGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
971865900 4:32171568-32171590 TGGGCTACTTAGGTAAATACAGG + Intergenic
972286166 4:37650617-37650639 TGGGCATCTTTTGGAGAAAAGGG + Intronic
976090495 4:81452279-81452301 TGTGTATCTTTGGTAGAAATGGG + Intronic
977170912 4:93761422-93761444 TGGGCTTTATTTGTAAAAACAGG - Intronic
977213999 4:94257291-94257313 TGGGTATCTTTGGTAGAATTTGG - Intronic
980374862 4:131931648-131931670 TGGCCATCAATGGTAAAGACTGG - Intergenic
982282906 4:153704102-153704124 TTGGCATCATTGGAAAAAACCGG + Exonic
983203263 4:164885300-164885322 TGGGTATTTTTAGTAGAAACGGG + Intronic
984134608 4:175920022-175920044 TGGCCATCTTTGGTCATAAAAGG + Intronic
985035586 4:185836851-185836873 GGTGCATTTTTGCTAAAAACTGG + Intronic
987070497 5:14333018-14333040 TGGCCGTCTTTAGTAAAAACTGG - Intronic
988877191 5:35459439-35459461 TGGGTATCTTTGCTAATAAGTGG - Intergenic
989478930 5:41905440-41905462 TTGGCATATTTTGTAGAAACGGG + Intronic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
992948764 5:81835930-81835952 TGGCCATCTGTGGCACAAACCGG - Intergenic
996176999 5:120370725-120370747 TGGGCATCACTGGCAAAAACAGG + Intergenic
997554175 5:134780391-134780413 TTTGCATCTTTAGTAGAAACAGG - Intronic
998126526 5:139626462-139626484 TGGACATCTTTTGTAGAAATAGG + Intronic
999172374 5:149606392-149606414 TGGGGATCTTTGCTGAGAACTGG + Intronic
999578355 5:153006194-153006216 GGGGCATCCTTGCTATAAACTGG + Intergenic
1002603031 5:180365401-180365423 TTGGTATTTTTGGTAGAAACAGG - Intergenic
1003276005 6:4653731-4653753 TTGGTATTTTTGGTAGAAACTGG + Intergenic
1004037192 6:11934820-11934842 TGGGCAGCTTTGATAACAAGCGG + Intergenic
1004087979 6:12470744-12470766 AAGGCATATTTGGTAAACACTGG - Intergenic
1004918283 6:20352769-20352791 TGGCTATTTTTTGTAAAAACAGG - Intergenic
1005649507 6:27873683-27873705 TGGGCATCATTTTTAGAAACTGG - Intergenic
1005668838 6:28084183-28084205 ATGGGATCTTTGGTAGAAACAGG - Intronic
1006330604 6:33387882-33387904 TTGGCATTTTTAGTAGAAACGGG - Intergenic
1010900184 6:81418017-81418039 TGGGCATATTTCATAAAATCTGG + Intergenic
1011174840 6:84548903-84548925 TGGGCATGTTTTCTAAGAACAGG - Intergenic
1011601284 6:89062514-89062536 TCTGCATCTTTAGTAGAAACAGG - Intergenic
1012042553 6:94227452-94227474 GGAGCATCTTTGGTTAAAGCAGG + Intergenic
1012951389 6:105521785-105521807 TTGGCATTTTTAGTAGAAACAGG + Intergenic
1013471262 6:110468471-110468493 TTGGCATTTTTAGTAGAAACAGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015533019 6:134240118-134240140 TTGGTATTTTTGGTAAAGACAGG - Intronic
1018581756 6:165314052-165314074 TGGGCATCTTGGGTCAAGACAGG + Intergenic
1019506079 7:1392149-1392171 GGGGCATCTGTGGGAAAAGCCGG + Intergenic
1021936457 7:25636770-25636792 TGGGCAGTTTAGGTGAAAACCGG + Intergenic
1024745939 7:52406169-52406191 TGGGCATCTCTGGCAAACTCTGG - Intergenic
1024827170 7:53404194-53404216 TGGGCGTCCTTGGAAAAAATAGG + Intergenic
1026925195 7:74187256-74187278 TGTGCATTTTTAGTAGAAACAGG - Intronic
1027377984 7:77573437-77573459 CGGGCCTCTTTAGTAAAAGCTGG + Intronic
1027741324 7:82009957-82009979 TGGTCATTTTTGGTAATAAGGGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030252906 7:107467711-107467733 TTTGCATATTTGTTAAAAACAGG + Intronic
1031164952 7:118216695-118216717 TTGGCATCTTTGGTGAAATCAGG + Intronic
1032003036 7:128277994-128278016 TGGCCATTTTTGGTAGAGACGGG - Intergenic
1032277039 7:130466950-130466972 GGGGTATTTTTGGTAGAAACGGG + Intergenic
1033186073 7:139227789-139227811 TTGGAATCGTTGGTAAATACAGG - Intergenic
1033353454 7:140581089-140581111 TGGGTATTTTTAGTAAAGACAGG - Intronic
1033674652 7:143528344-143528366 TTTGTATCTTTAGTAAAAACGGG - Intergenic
1033697184 7:143801096-143801118 TTTGTATCTTTAGTAAAAACGGG + Intergenic
1037552761 8:19991073-19991095 TGGCTCTCTTTGGTAAGAACTGG - Intergenic
1037919246 8:22792543-22792565 AGGGCATCTTTGGTTATGACTGG - Intronic
1038483845 8:27919836-27919858 TGGGCATCTTTTGAAAACAATGG - Intronic
1038869513 8:31479174-31479196 TGGGCATGTTTAGGAAACACTGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039269541 8:35865937-35865959 TTTGCATTTTTGGTAAAGACAGG - Intergenic
1040572576 8:48623765-48623787 TGGGCTTCTCTGCTAAGAACTGG + Intergenic
1042441313 8:68829663-68829685 TGAACATCTTTGGCAAAGACAGG + Intergenic
1042923272 8:73940816-73940838 TTGGTATTTTTAGTAAAAACGGG + Intronic
1043867230 8:85389292-85389314 TTTGCATTTTTGGTAAAGACAGG - Intronic
1045585033 8:103524954-103524976 TGGGAAGCACTGGTAAAAACTGG - Intronic
1045786818 8:105931438-105931460 TGGACATATATGGTAAAAAGGGG + Intergenic
1046049414 8:109003954-109003976 TGGGAATCTTTGCTCAAAAAGGG + Intergenic
1047270967 8:123358517-123358539 TGGGTATTTTTAGTAAAGACAGG + Intronic
1049114944 8:140678217-140678239 TTTGTATTTTTGGTAAAAACGGG + Intronic
1049779421 8:144421843-144421865 TGTGTATTTTTAGTAAAAACAGG - Intergenic
1050653623 9:7799758-7799780 TGGGCGTCTTTGGTTCAAACTGG + Exonic
1050655684 9:7826141-7826163 AGGGCATGTTTGGTAAAAAGAGG - Intronic
1051565227 9:18489903-18489925 TGGGCATTTTAGGAAAAAAGGGG - Intronic
1052801396 9:32971370-32971392 TGGGCATATTAGTTAAAAACAGG - Intergenic
1053215115 9:36264440-36264462 AGGGCATCTTTTTTAAAAAGAGG - Intronic
1055652565 9:78420933-78420955 TTGGTATCTTTAGTAAAGACAGG + Intergenic
1057099840 9:92348128-92348150 TGTGCATTTTTGGTAGAGACAGG + Intronic
1058082820 9:100717377-100717399 TGGGAAGCTTTGGTGAAACCTGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058674478 9:107388754-107388776 TTTGCATCTTTAGTAGAAACGGG - Intergenic
1058924817 9:109652725-109652747 TGGGTATCTGTGGTACAAATAGG + Intronic
1059376970 9:113889648-113889670 TGGCCATCTTTGGAAAACAAGGG + Intronic
1059787579 9:117602412-117602434 TTGGCACCTTTGTTTAAAACTGG - Intergenic
1062136844 9:134933640-134933662 GGGGCAGCTGTGGTAGAAACAGG + Intergenic
1186311901 X:8329248-8329270 TTTGCATTTTTGGTAAAGACAGG - Intergenic
1188752040 X:33916636-33916658 TGATCATCTTTGGTAGAAATGGG + Intergenic
1190092544 X:47452145-47452167 TGGGCATCTTTGCCAACATCTGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193985152 X:88231949-88231971 TTGGCACCTTTGGCAAAAATAGG - Intergenic
1196358090 X:114818682-114818704 GCTGCCTCTTTGGTAAAAACAGG + Intronic
1196637918 X:118025103-118025125 TGGCCATGTTGGGTGAAAACAGG - Intronic
1196795521 X:119499442-119499464 TTGGCATTTTTGGTAGAGACAGG + Intergenic