ID: 1075635432

View in Genome Browser
Species Human (GRCh38)
Location 10:124027245-124027267
Sequence ACCGCTCCTCCAGGGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075635432_1075635440 -1 Left 1075635432 10:124027245-124027267 CCTGGGACCCCTGGAGGAGCGGT 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1075635440 10:124027267-124027289 TGGGATGGGAAATGTATGTTAGG No data
1075635432_1075635443 2 Left 1075635432 10:124027245-124027267 CCTGGGACCCCTGGAGGAGCGGT 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1075635443 10:124027270-124027292 GATGGGAAATGTATGTTAGGGGG No data
1075635432_1075635442 1 Left 1075635432 10:124027245-124027267 CCTGGGACCCCTGGAGGAGCGGT 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1075635442 10:124027269-124027291 GGATGGGAAATGTATGTTAGGGG No data
1075635432_1075635441 0 Left 1075635432 10:124027245-124027267 CCTGGGACCCCTGGAGGAGCGGT 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1075635441 10:124027268-124027290 GGGATGGGAAATGTATGTTAGGG No data
1075635432_1075635445 9 Left 1075635432 10:124027245-124027267 CCTGGGACCCCTGGAGGAGCGGT 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1075635445 10:124027277-124027299 AATGTATGTTAGGGGGCATAGGG No data
1075635432_1075635444 8 Left 1075635432 10:124027245-124027267 CCTGGGACCCCTGGAGGAGCGGT 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1075635444 10:124027276-124027298 AAATGTATGTTAGGGGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075635432 Original CRISPR ACCGCTCCTCCAGGGGTCCC AGG (reversed) Intronic
900117394 1:1034443-1034465 TCCGCCGCCCCAGGGGTCCCAGG + Intronic
900147412 1:1164499-1164521 CCAGCTCCTCCAGGGATCCAGGG - Intergenic
900156815 1:1206473-1206495 AGCGCCCCACCGGGGGTCCCGGG - Exonic
900342531 1:2195600-2195622 ACCCCTCCTGCAGGGCTCCCTGG + Intronic
900374772 1:2348472-2348494 GCCGCTTCTCCAGGGAACCCCGG + Intronic
900520024 1:3100960-3100982 CCCCCTCCTCCAGGCCTCCCGGG - Intronic
900602510 1:3509231-3509253 TCGGCTCCTCCAGGGCTGCCAGG + Exonic
901600820 1:10422145-10422167 ACCACTGCTCCAGGGGTCCAGGG - Intergenic
902238735 1:15074381-15074403 CAAGCTCCTCCAGGGGTCTCTGG + Intronic
902448700 1:16483776-16483798 ACCCCACCCCCAGGGCTCCCAGG + Intergenic
905036152 1:34919274-34919296 TCCCCTCCACCAGAGGTCCCTGG + Intronic
905168702 1:36098143-36098165 ACGGGGCCCCCAGGGGTCCCTGG - Exonic
905269088 1:36774989-36775011 ATTCTTCCTCCAGGGGTCCCAGG + Intergenic
905343418 1:37294945-37294967 ACCCCTCTTCCAGGCGTCTCCGG - Intergenic
905651864 1:39662008-39662030 TGGGCTCCTCCAGGGGTCCAAGG + Intronic
906222637 1:44093747-44093769 AACCCTCCTCCAGAGGTCTCTGG - Intergenic
908935858 1:69374481-69374503 ACCCCTTCTCCAGGAGTCACTGG + Intergenic
910485226 1:87705764-87705786 ACCCCTCACCCATGGGTCCCTGG + Intergenic
912519916 1:110238225-110238247 ACTGCTCTTCTAGGGATCCCTGG - Intronic
913963157 1:143354342-143354364 ACCGCCCCTCCGGGGGGCCGGGG - Intergenic
914057513 1:144179928-144179950 ACCGCCCCTCCGGGGGGCCGGGG - Intergenic
914121633 1:144786438-144786460 ACCGCCCCTCCGGGGGGCCGGGG + Intergenic
915445785 1:155974262-155974284 ACCTCTCCTCCAGCTGTACCTGG + Intronic
915982350 1:160428222-160428244 ACTTCTCCTCCATTGGTCCCAGG + Exonic
1063452781 10:6162824-6162846 GCCACTCCTCCAAGGATCCCTGG + Intronic
1064180312 10:13109053-13109075 CCCGCCCCACAAGGGGTCCCCGG - Intronic
1067098263 10:43316370-43316392 ACCCCTACTGAAGGGGTCCCAGG - Intergenic
1070785230 10:79158718-79158740 GCCCCACCTCCAGGGATCCCTGG - Intronic
1071298167 10:84237544-84237566 ACAGCTGCTCCAGGCGGCCCAGG + Exonic
1073084524 10:100879628-100879650 CCAGCACCTCCAGGGTTCCCTGG - Intergenic
1073357667 10:102869922-102869944 ACCCCGACTCCAGGAGTCCCGGG - Intronic
1073481613 10:103789434-103789456 AGTGCTCCTCCAGAGGTGCCAGG + Intronic
1075080488 10:119380403-119380425 ACCTCTGCTCCAGTGTTCCCAGG + Intronic
1075635432 10:124027245-124027267 ACCGCTCCTCCAGGGGTCCCAGG - Intronic
1076096298 10:127737082-127737104 TTCGCTCCTCCAGGGCTGCCAGG + Intergenic
1076291587 10:129349714-129349736 AGCTCTGCTTCAGGGGTCCCCGG - Intergenic
1076801858 10:132834694-132834716 GAAGCTCCTCCAGGGGCCCCAGG + Exonic
1077367228 11:2166135-2166157 GCAGCCCCTCCAGGGGTCTCTGG + Intronic
1078598624 11:12711504-12711526 ACCCTTTCCCCAGGGGTCCCTGG + Intronic
1079967261 11:26994486-26994508 AAGTCTCCTCCTGGGGTCCCTGG + Exonic
1083476068 11:62916497-62916519 ACCTCTCCTAGAGGGGTCCTTGG + Intronic
1083675718 11:64323654-64323676 GCCACCCCTTCAGGGGTCCCAGG + Intergenic
1084422013 11:69065253-69065275 AGCGCTACTGCAGGGGTCACTGG - Intronic
1089329472 11:117679601-117679623 AGCTCTCCTCCTGGGGGCCCTGG + Intronic
1090844083 11:130516574-130516596 CCTGCAGCTCCAGGGGTCCCTGG - Intergenic
1090954729 11:131504074-131504096 ACTGCTCATCCAGGGCTCCCTGG + Intronic
1091316224 11:134615820-134615842 GCCACTGCTCCAGGGGTCCCAGG + Intergenic
1091692765 12:2608422-2608444 ACCACTGCTCCAGGGATCCCAGG - Intronic
1094833365 12:34310944-34310966 GCAGCTCCTGCACGGGTCCCGGG + Intergenic
1096095820 12:48934934-48934956 GCCTCTCCTCCTGGGCTCCCGGG - Intronic
1102214087 12:111147842-111147864 ACGAGTCCTCCAGGGGGCCCAGG + Intronic
1107126421 13:36851324-36851346 GCTCTTCCTCCAGGGGTCCCTGG + Intronic
1107605093 13:42048804-42048826 GCCGCTCCTCCAGCGGCGCCCGG - Exonic
1112807656 13:103180861-103180883 TCAGCTCCTCCAAGCGTCCCAGG + Intergenic
1113982774 13:114290103-114290125 AACACTCCCCCAGGGGTCCCTGG - Intronic
1119697119 14:76721859-76721881 ACTGGTCCTACAGGGGGCCCAGG - Intergenic
1121667805 14:95686168-95686190 ACAGCCCCTCCAGGAGACCCAGG + Intergenic
1122486484 14:102085678-102085700 ACCGCATCCCCAGGGGTCCAAGG + Intronic
1122636776 14:103133669-103133691 CCCACTCCTGCAGGGCTCCCCGG + Exonic
1128424044 15:67521517-67521539 ACCACTGCTCCAAGGCTCCCTGG + Exonic
1131922938 15:97350139-97350161 ACCACACCTCCTGGTGTCCCAGG + Intergenic
1132675156 16:1118386-1118408 CCCCCACCTCCTGGGGTCCCAGG + Intergenic
1132745072 16:1433103-1433125 AGAGCTCGGCCAGGGGTCCCAGG - Intergenic
1132757833 16:1494518-1494540 ACAGCTCCTCCAGGCGGCCATGG - Exonic
1133070620 16:3244336-3244358 ACCTCTCCTCCATCTGTCCCTGG - Intronic
1134213732 16:12299530-12299552 CCTGTTCCTCCAGGGGGCCCTGG + Intronic
1136070532 16:27784554-27784576 CCCGCTCCCCCTGGAGTCCCAGG + Intergenic
1136169197 16:28477936-28477958 GCCTCCCCTCCAGGGGTCCCTGG + Intronic
1138443282 16:57047608-57047630 ACTGCAGTTCCAGGGGTCCCGGG - Exonic
1139851408 16:69953032-69953054 GCAGCCCCTCCTGGGGTCCCAGG - Intronic
1139880386 16:70175944-70175966 GCAGCCCCTCCTGGGGTCCCAGG - Intronic
1140372124 16:74419573-74419595 GCAGCCCCTCCTGGGGTCCCAGG + Intronic
1143108060 17:4539220-4539242 GCCATTCCTGCAGGGGTCCCAGG - Intronic
1147561393 17:41511498-41511520 ACAGCCCCTCCAGGCATCCCAGG + Intergenic
1148080056 17:44963022-44963044 GCAGCTCCTCCTGGGGTCCAAGG + Intronic
1148742685 17:49901832-49901854 ATCACTCCTCCAGGGAGCCCTGG + Intergenic
1150653904 17:67027240-67027262 ACGGCTCCTCCTGGGGGCACGGG - Intronic
1151328688 17:73394180-73394202 ACCCCACCTCCTGGGATCCCGGG + Intronic
1151434876 17:74089070-74089092 ACAGCTCCTGCAGTGGTCCAGGG - Intergenic
1151482966 17:74380918-74380940 ACTGAACCTCCAGAGGTCCCAGG - Intergenic
1151977946 17:77492902-77492924 GCAGCTCCTCCCGGGGGCCCAGG + Intronic
1152123201 17:78431457-78431479 ACAGCTCCCCCAGGAGTCTCGGG - Intronic
1152729359 17:81961945-81961967 TCCGCTTCTCCAGGAGGCCCCGG - Intergenic
1154467394 18:14660827-14660849 ACTGCACCTCCAGGTGTCACAGG - Intergenic
1159349934 18:67259304-67259326 ACCACACTTTCAGGGGTCCCTGG + Intergenic
1160177678 18:76609167-76609189 GCCGGTCCTCAAGTGGTCCCAGG - Intergenic
1160371783 18:78378090-78378112 ACCCCTGCTCCAGGGATCCATGG + Intergenic
1160568671 18:79801949-79801971 ACCCCTTCGCCAGGGGTCCCAGG + Intergenic
1160701843 19:511285-511307 CCCGCCCCTCCTGGGCTCCCGGG - Intronic
1160752674 19:741780-741802 CCTCCTCCTCCTGGGGTCCCTGG - Intronic
1162322945 19:9980646-9980668 ACCTTTTCTCCAGGGATCCCAGG + Exonic
1162524238 19:11197926-11197948 ACCCCTCCCCCAGGCGGCCCAGG + Intergenic
1162951279 19:14073285-14073307 ACCGCTCCTCCGGGGGACGCTGG - Exonic
1163544516 19:17933131-17933153 ACCCCTCCTCCAGCCTTCCCAGG - Intronic
1163551867 19:17969835-17969857 TGCCCTCCTCCAGGGGGCCCAGG - Intronic
1163786009 19:19275296-19275318 ACCGCCCCACCACGGCTCCCTGG + Intergenic
1163833929 19:19562190-19562212 GCGGAGCCTCCAGGGGTCCCTGG + Intronic
1165073785 19:33269767-33269789 CCTGCCCATCCAGGGGTCCCGGG + Intergenic
1167449666 19:49559818-49559840 ACTGCTCATCCAGGGTTCCCTGG + Intronic
1167476777 19:49706006-49706028 ACTGCTGCTCCAGGGCTCTCGGG - Exonic
1168584735 19:57583484-57583506 ACGTCTCCTCCAGGGGGGCCGGG - Intronic
1202696997 1_KI270712v1_random:132601-132623 ACCGCCCCTCCGGGGGGCCGGGG - Intergenic
925145001 2:1575477-1575499 ACAGCTCCTCACGGGGCCCCTGG + Intergenic
925406116 2:3606349-3606371 ACAGCACATCCAGGGGACCCAGG - Intronic
925928324 2:8685826-8685848 GCTGCGGCTCCAGGGGTCCCGGG - Intergenic
927206642 2:20615355-20615377 ACTGCTCCTCCACCGGCCCCTGG + Intronic
927736320 2:25525847-25525869 ACCCCTCCTTCAGAGGTTCCAGG - Intronic
928904599 2:36356157-36356179 ACCGCCCCTCTCGGGGCCCCCGG - Exonic
929532810 2:42763156-42763178 ACAGCTCTTCCATGGCTCCCTGG - Exonic
929899205 2:45986779-45986801 CCCCCACCTCCAGGGGTGCCGGG - Intronic
930445338 2:51463851-51463873 AGCCCTCCTCCAGGGCTCTCTGG + Intergenic
932619252 2:73256148-73256170 AGCCCTGCTCCAGGGGCCCCAGG - Exonic
932712062 2:74073619-74073641 ACCGCTCCTCCATGAGTTCCCGG - Exonic
933185696 2:79277063-79277085 ACAGCTCCTCCATGGCTCTCTGG - Intronic
934131880 2:88956297-88956319 ACAGCTCTGCCTGGGGTCCCAGG - Intergenic
934278158 2:91589615-91589637 ACCGCCCCTCCGGGGGGCCGGGG - Intergenic
935285614 2:101561420-101561442 AGCACCCCTTCAGGGGTCCCTGG + Intergenic
935319641 2:101873435-101873457 ACGGCTCCTGCAGTGGTTCCAGG + Intronic
942340081 2:174934541-174934563 ACCTCTAATACAGGGGTCCCCGG - Intronic
943455499 2:188102620-188102642 ACCCCTTCTCCAGGAGTCCTTGG - Intergenic
948865671 2:240773546-240773568 TCCTCTCCCCCAGTGGTCCCAGG + Intronic
1169150683 20:3287016-3287038 ACCACTGCTCCAGGGGACCCTGG - Intronic
1171044694 20:21798817-21798839 ACCCTTGCTCCAGAGGTCCCAGG + Intergenic
1172670656 20:36632624-36632646 AAGGCCCCTCCAGGGTTCCCAGG + Exonic
1172773466 20:37394606-37394628 TCCTCTTCCCCAGGGGTCCCTGG + Intronic
1173741720 20:45406619-45406641 GCTGCGCCTCCAGGGCTCCCGGG - Intronic
1173809906 20:45949332-45949354 CCCGTTCCTTCAGGAGTCCCAGG - Exonic
1175878048 20:62239561-62239583 ACCCCTTCTCCAGGTGTTCCGGG - Intronic
1176128861 20:63487898-63487920 ACCGCCCACCCTGGGGTCCCCGG + Intergenic
1176247395 20:64103989-64104011 ACCGCCCCACGAGGTGTCCCAGG - Intergenic
1176385844 21:6138230-6138252 CCCGCTCCTCCGGGGCCCCCAGG - Intergenic
1176807118 21:13496856-13496878 ACTGCACCTCCAGGTGTCACAGG + Intergenic
1176952782 21:15065392-15065414 ACAGCTCCTCCTGGGGACCGGGG + Intergenic
1178913935 21:36696699-36696721 ACCGCACCTCGAGGTTTCCCAGG - Intergenic
1179737629 21:43400022-43400044 CCCGCTCCTCCGGGGCCCCCAGG + Intergenic
1181085401 22:20437377-20437399 ACTTCTCGTCCAGGGTTCCCTGG + Intronic
1183403184 22:37616815-37616837 AGCCCTCCTCCAAGGGGCCCTGG - Intronic
1184726573 22:46350792-46350814 CCTGCCCCTCCAGGGGTCTCGGG - Intronic
1184923719 22:47623379-47623401 ACCGCCTGTCCAGGGGGCCCCGG - Intergenic
950647614 3:14386670-14386692 AGGGCTGCTCCAAGGGTCCCAGG + Intergenic
950714385 3:14837327-14837349 ACCGCCCCTCCTGGGGTTACAGG - Intronic
950810541 3:15646260-15646282 ACAGCTCATCCAGGGATTCCAGG + Intergenic
952825012 3:37517500-37517522 GCTGCTCCTCGAGGGCTCCCTGG - Exonic
954422418 3:50425707-50425729 CCCACTTCTCCGGGGGTCCCAGG - Intronic
958437070 3:94109712-94109734 ACAGCTCCTCCAGGAATCACAGG - Intronic
960520237 3:118646384-118646406 ACCGTTCCTCCAGGTCTCCAAGG - Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
968395665 4:234341-234363 AGGTCTCCTCCAGGGGTCGCAGG + Intergenic
968903978 4:3443399-3443421 ACCCCGCCTCCAGGGGGCCCAGG + Exonic
969626128 4:8306623-8306645 ACCTGTCCTCCAGGGACCCCAGG - Exonic
969702319 4:8774272-8774294 TTCCCACCTCCAGGGGTCCCAGG - Intergenic
973632226 4:52830283-52830305 ACAGCTCTTCCAGGGATCCAGGG + Intergenic
975575983 4:75863124-75863146 ATCCCTCCTCCACGAGTCCCTGG - Intronic
990655577 5:57950934-57950956 ACAGCTCCTCCAGGATTCCTGGG - Intergenic
991534635 5:67654449-67654471 ACCATTCCTCCAGAGGGCCCTGG - Intergenic
999194384 5:149772104-149772126 GCGGCTCCTCCAAGGGTCCTGGG - Intronic
1002591959 5:180296648-180296670 ACCATTTCTCCAGGGATCCCTGG - Intergenic
1002800111 6:514645-514667 ACAGCTGCTCCAGGGGCTCCAGG + Intronic
1003143656 6:3492130-3492152 AGCGGTGCTCCAGGGGTCTCAGG - Intergenic
1007702456 6:43772925-43772947 ACCGCCCCTCCTGTGCTCCCTGG + Intronic
1007710100 6:43817435-43817457 ATCCCACCTCCAGGGCTCCCTGG - Intergenic
1007749085 6:44061067-44061089 GCTGTCCCTCCAGGGGTCCCAGG - Intergenic
1016966361 6:149721735-149721757 ACCATTCCTCCAAGGATCCCTGG + Intergenic
1017182282 6:151564885-151564907 AGCACTCCTCCAGGAGTCCAGGG - Intronic
1018659639 6:166074033-166074055 ACGGCTCCTCCACCTGTCCCTGG - Intergenic
1021959686 7:25859106-25859128 GCGGATCCTCCACGGGTCCCCGG - Intergenic
1026019946 7:66698677-66698699 CCCCCTCCTCCAGGGCTCCAAGG + Intronic
1029453699 7:100656422-100656444 CCCGCCCCGCCAGGGATCCCGGG - Exonic
1030307461 7:108033492-108033514 ATCGCTCCTCCAGGGGGCGGAGG - Intronic
1034444316 7:151104951-151104973 ACCGCCCCGCCAGGGGCACCTGG - Intronic
1036558804 8:9884189-9884211 GCAGCTCCTCCAGGGTTCCCAGG - Intergenic
1044855240 8:96468584-96468606 TACCCTCCTCCAGGGGTTCCTGG - Intergenic
1046080289 8:109362707-109362729 ACCCCTGCTCCCGGGGTCCTGGG + Intronic
1049687634 8:143945269-143945291 ACAGCCTCTCCTGGGGTCCCAGG + Intronic
1049762945 8:144339036-144339058 CCCTCCCCGCCAGGGGTCCCGGG - Intergenic
1053412275 9:37923443-37923465 ACCGCCCCCCCAGGGGTCCGAGG + Intronic
1059329495 9:113525898-113525920 ACCTCTCCCCCAGGGCTCCTGGG + Intronic
1059663616 9:116425460-116425482 AGGTCTCCTCCAGGGGTCCATGG + Exonic
1060827570 9:126695584-126695606 CCCGCCCCTCCAGGGGATCCAGG - Intronic
1061153972 9:128846036-128846058 TCCGCTCCTCGGAGGGTCCCGGG + Intronic
1062112495 9:134789800-134789822 ACCGCTCCTGCAGGGAGGCCTGG - Intronic
1062228244 9:135465881-135465903 ACTGGGCCTCCTGGGGTCCCTGG + Intergenic
1062387285 9:136317852-136317874 ACCCCTCCTCCAGCGGTCCTGGG - Intergenic
1203783733 EBV:115608-115630 CCCGCCCCTCCGGGGGGCCCAGG + Intergenic
1186430521 X:9500662-9500684 ACCGCTACTGCAGGAGCCCCAGG - Intronic
1188310619 X:28612384-28612406 AACGCCCCGCCCGGGGTCCCTGG - Intronic
1189719319 X:43899070-43899092 TCTGCTCCTGCTGGGGTCCCAGG - Intergenic
1189850122 X:45169506-45169528 ACCTCTCCTCCAGCTGGCCCAGG + Intronic
1193294846 X:79822039-79822061 AAAGCTCCTCCATGGGGCCCAGG - Intergenic
1197175134 X:123477633-123477655 AGGGATCCTCCGGGGGTCCCTGG + Intronic
1199996999 X:153031714-153031736 ATCCCTCCTCCTGGGGTTCCTGG - Intergenic
1200034202 X:153317805-153317827 CCCCCTCCTCCTGGGGTTCCTGG + Intergenic
1200044786 X:153395753-153395775 CCCCCTCCTCCTGGGGTTCCTGG + Intergenic
1200049015 X:153418610-153418632 TCAGCTCCTCCAGGGGCCCAGGG + Intronic
1201240508 Y:11953621-11953643 CCCGCTTCTCCAGGACTCCCGGG - Intergenic