ID: 1075636315

View in Genome Browser
Species Human (GRCh38)
Location 10:124033194-124033216
Sequence CAACCATTTCAGACAGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075636312_1075636315 4 Left 1075636312 10:124033167-124033189 CCTTTCTGGCTGAGATGGGAAAC No data
Right 1075636315 10:124033194-124033216 CAACCATTTCAGACAGGCCATGG No data
1075636308_1075636315 27 Left 1075636308 10:124033144-124033166 CCTAAACACACAGTATTTATCAT 0: 1
1: 0
2: 1
3: 36
4: 353
Right 1075636315 10:124033194-124033216 CAACCATTTCAGACAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075636315 Original CRISPR CAACCATTTCAGACAGGCCA TGG Intronic
No off target data available for this crispr