ID: 1075638937

View in Genome Browser
Species Human (GRCh38)
Location 10:124050526-124050548
Sequence GGGGTGCTATGGCATCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075638937_1075638946 13 Left 1075638937 10:124050526-124050548 CCCACTGGATGCCATAGCACCCC No data
Right 1075638946 10:124050562-124050584 TCACAACCAAAAATGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075638937 Original CRISPR GGGGTGCTATGGCATCCAGT GGG (reversed) Intronic