ID: 1075638937

View in Genome Browser
Species Human (GRCh38)
Location 10:124050526-124050548
Sequence GGGGTGCTATGGCATCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 6, 3: 16, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075638937_1075638946 13 Left 1075638937 10:124050526-124050548 CCCACTGGATGCCATAGCACCCC 0: 1
1: 0
2: 6
3: 16
4: 127
Right 1075638946 10:124050562-124050584 TCACAACCAAAAATGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075638937 Original CRISPR GGGGTGCTATGGCATCCAGT GGG (reversed) Intronic
902988272 1:20169020-20169042 GGGCTGCTCTGGGATGCAGTAGG - Intronic
903508422 1:23854747-23854769 GGGGTGGTATGCCATCTAGTGGG + Intronic
904287740 1:29462831-29462853 GAGTTGCTATTGCATCCTGTAGG + Intergenic
904913696 1:33954320-33954342 GGGTTGCTATGGAAACCTGTAGG + Intronic
904994211 1:34618301-34618323 GGGTTGCACTGGCATCTAGTGGG + Intergenic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
910033182 1:82756993-82757015 AGAGTGCTATGGCATCTAGACGG + Intergenic
913188011 1:116387766-116387788 GCTGTGCTCTGCCATCCAGTGGG - Intronic
914708053 1:150187688-150187710 GGAGTGCTACTGCATCAAGTGGG - Intergenic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
920217081 1:204368557-204368579 GAGGTGCTATGGCCACCTGTGGG - Intronic
922177865 1:223211134-223211156 GGGGTACTATTGCATCTTGTGGG - Intergenic
924671946 1:246137580-246137602 AGGTTGTTATGGTATCCAGTGGG - Intronic
924772237 1:247088342-247088364 TGGCTGCTATGGCATCTGGTGGG - Intergenic
1065780340 10:29161078-29161100 CAGGTGCTATGGCACCCAGATGG - Intergenic
1068011729 10:51460117-51460139 GGGGTCCTCTGGCATTTAGTGGG - Intronic
1069242668 10:66162619-66162641 GGGGTGCTATGGACTCCATGAGG + Intronic
1070287702 10:75095656-75095678 GGAGTACTATGGCATCGAGGCGG - Exonic
1072663335 10:97376689-97376711 TGGGTGCTCTGGCATCTAGTGGG - Intronic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1075653850 10:124148133-124148155 AGGATGCTATGGCATCTAGGAGG - Intergenic
1076783980 10:132739933-132739955 GGAGTCCTCTGGCATCCCGTTGG - Intronic
1083486569 11:62986544-62986566 GGGTTTCCATGGGATCCAGTTGG + Intergenic
1083663956 11:64264860-64264882 GGGGTGCTAGGGGACCCAGGAGG + Intronic
1087749272 11:101989383-101989405 GAAGTGCTGTGGCATCTAGTGGG - Intronic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1090093444 11:123720941-123720963 GGAGTGCAATGGCATCATGTTGG - Intergenic
1091229361 11:133977755-133977777 GTGGTGCTGTGGGATCCAGGTGG - Intergenic
1092074521 12:5662000-5662022 GGGGCGCCATGGGAGCCAGTTGG - Intronic
1094042359 12:26131582-26131604 GGAGGGCTATGCTATCCAGTTGG + Intronic
1096669500 12:53190192-53190214 GGAGTGATTTGGCATCCAGAGGG + Exonic
1098349096 12:69538938-69538960 GGGGTGTCATGGCATCTAGGAGG - Intronic
1104576537 12:129971862-129971884 GAGGTGCTATGGCACCTAGTGGG - Intergenic
1104582537 12:130021735-130021757 AGGTTGCTATGGCATCTAATGGG + Intergenic
1104654120 12:130560440-130560462 GGGGTCTAGTGGCATCCAGTGGG - Intronic
1104906324 12:132215377-132215399 GGGCTGCAGTGGCATCCAGGCGG - Intronic
1106486985 13:30180919-30180941 GAGGTGCTGGAGCATCCAGTGGG + Intergenic
1111174374 13:84574140-84574162 GTGGTGCTATGGAAGCCAGGTGG + Intergenic
1125402837 15:39322369-39322391 GGGGGGCTTTGGGATCCTGTAGG - Intergenic
1126103785 15:45135063-45135085 GGGGTGCTAGGGCAAGCAGAGGG - Intronic
1128570181 15:68728049-68728071 GGGTTGCTATGGCATCTGATTGG - Intergenic
1130127468 15:81105695-81105717 GGGCTGCTATGAGATCCAGATGG + Intronic
1130366976 15:83249482-83249504 GGGGTGCTATGGCATTTAGTGGG + Intergenic
1131788410 15:95937775-95937797 GGGGTGTATAGGCATCCAGTGGG - Intergenic
1132610947 16:816124-816146 GGGGTGCTCAGGCAGCCAGACGG - Intergenic
1132646762 16:1002798-1002820 GGGGTGCTGTGGCATCCAGCGGG - Intergenic
1134083682 16:11341936-11341958 AGGGTGCCATGGCATCTCGTGGG + Intronic
1134344060 16:13373025-13373047 AGGGTGCTATGGCCTCCAAGGGG - Intergenic
1134628825 16:15742054-15742076 GGGTGCCTCTGGCATCCAGTGGG + Intronic
1136265905 16:29118228-29118250 GGGGTGCTTTGAGATCCCGTGGG - Intergenic
1136295983 16:29302223-29302245 GGGGTGCTGGGGAAACCAGTAGG - Intergenic
1138431802 16:56973527-56973549 GGGCTGCTAGGGGATCCAGATGG + Intronic
1139434194 16:66926692-66926714 GGGGTGGGAGGGCATCCATTTGG + Intergenic
1142054716 16:87986133-87986155 GGGGTGCTTTGAGATCCCGTGGG - Intronic
1142101903 16:88276410-88276432 GGGGTGCTGGGGAAACCAGTAGG - Intergenic
1147124540 17:38357138-38357160 AGGCTGCTTTGGCATCCATTTGG + Intronic
1147565134 17:41531287-41531309 GGGGTTCTGTAGAATCCAGTTGG - Intergenic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1148604333 17:48917425-48917447 TGGGGGTTGTGGCATCCAGTGGG + Intronic
1148777702 17:50104917-50104939 GGGGTGTTGTTGCATCCAGTGGG - Intronic
1152855930 17:82664427-82664449 GGGGTGCTATGCCAGCCAGGGGG + Intronic
1155023448 18:21917998-21918020 GGGGAGCTATGCCATCCTCTTGG - Intergenic
1158985219 18:62808601-62808623 GGGGTGCAATGGCACCATGTTGG + Intronic
1160770402 19:828442-828464 GGGGGGCTTAGGCATTCAGTGGG + Intronic
1163832247 19:19552678-19552700 GAGGTGCTTCCGCATCCAGTGGG - Intergenic
1167504469 19:49863805-49863827 GGGCTGGGGTGGCATCCAGTAGG - Intronic
934147343 2:89108524-89108546 GGAGTGCAATGGCATCATGTCGG + Intergenic
934221928 2:90092068-90092090 GGAGTGCAATGGCATCATGTCGG - Intergenic
935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG + Intronic
937080741 2:119137839-119137861 GGGGAGCTCTGGCCTCCAGAAGG + Intergenic
938208406 2:129443281-129443303 GGGGTGAGCTGGCATCCAATGGG - Intergenic
941921293 2:170853564-170853586 GAAGTGCTACGGCATTCAGTGGG - Intronic
946072788 2:217048749-217048771 TGGATGCTCTGGCTTCCAGTAGG + Intergenic
946503430 2:220274421-220274443 GGAGTGCTATGGGAACCAATGGG - Intergenic
946532285 2:220583923-220583945 GGGGTGCCATGGCAACCAGATGG + Intergenic
946862691 2:224015023-224015045 GTGGTGCCATGGCATCTGGTAGG + Intronic
947843587 2:233225907-233225929 GAGGTGATATGGCTTCCAGCTGG - Intronic
948447439 2:238043739-238043761 GGGAAGCTCTGACATCCAGTTGG + Intronic
948625571 2:239266064-239266086 AGGCTGCTGTGGCATCCAGAGGG + Intronic
948924646 2:241087541-241087563 GGGGTGCTATGGGATGCTGCAGG + Exonic
1170567142 20:17613758-17613780 GAGGGGCTGTGGCCTCCAGTCGG + Exonic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1174199724 20:48798731-48798753 GAGGAGCTTTGGCATGCAGTAGG + Intronic
1175214538 20:57384758-57384780 GGGGAGCCAGGGCATCCATTTGG + Intergenic
1176127083 20:63480450-63480472 CAGATGGTATGGCATCCAGTGGG + Intergenic
1179485667 21:41708947-41708969 GGGGTGCTATGGCATGATCTTGG - Intergenic
1179774042 21:43648261-43648283 GGGCTGCTATTGCATCCAACAGG - Intronic
1180606810 22:17065157-17065179 GGGGTGGTATTCCAGCCAGTGGG - Intergenic
1181496004 22:23287903-23287925 GAGGTGCTGTGGCACCCAGCTGG + Intronic
1182863532 22:33582135-33582157 GGGGTGCTACTGGATCCAGGGGG + Intronic
1183235574 22:36614422-36614444 GGGGTGCCATGGGAACCAGAAGG - Intronic
1183512470 22:38244112-38244134 GGGGTGCAATGGGCTCCTGTTGG + Intronic
1183523295 22:38309087-38309109 GGGGTGCCCTGGCATCTAGTGGG - Intronic
1185159492 22:49214657-49214679 GGGTTGCTGTTGCATGCAGTAGG + Intergenic
952952449 3:38536150-38536172 GGTGTGTTATTGCTTCCAGTTGG + Intronic
953202036 3:40786491-40786513 GGGGTCATATGGCATGCAGCAGG - Intergenic
959713092 3:109404253-109404275 GGAGTGCAATGGCACCCTGTGGG + Intergenic
959902447 3:111675343-111675365 GGGGAGCGAGGCCATCCAGTCGG - Exonic
962746941 3:138403871-138403893 CGGGTGTCTTGGCATCCAGTTGG - Exonic
969364249 4:6684862-6684884 GAGGTGCTGTGGCATCCTGGTGG - Intergenic
969801413 4:9568535-9568557 TGGGTGCTGTGGCACCCAGGCGG + Intergenic
971536959 4:27765078-27765100 GTGGTGTTATGACATCCAGTTGG + Intergenic
973551962 4:52044547-52044569 GGGGTGCAATGGCATCATCTTGG - Intergenic
977564081 4:98563850-98563872 AGGGTGCACTGGCATCTAGTGGG + Intronic
979920907 4:126495025-126495047 GGGGTGGTAGGGCTTACAGTGGG - Intergenic
984189144 4:176583833-176583855 GGGGTGCTACTGAGTCCAGTGGG - Intergenic
986507476 5:8467406-8467428 GGGGTGGTAGGGCATCAGGTTGG - Intergenic
986826741 5:11530580-11530602 GGGGTGTTGTGGCATCCACAGGG + Intronic
993585036 5:89713665-89713687 GGAGTGCAATGGCATCCTCTTGG - Intergenic
1000298975 5:159937960-159937982 GGGAAGCTTTGGCCTCCAGTGGG - Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1001494584 5:172178905-172178927 GAGGTGTTCTGGCATCCAGTGGG + Intronic
1007359479 6:41344838-41344860 GGGGTGCTGTGGGCTCCAGGCGG + Intronic
1007464374 6:42041714-42041736 TGGGTGCTGTGGAATCCACTGGG - Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1013238077 6:108216329-108216351 GGGGTGCTATGTTGTCTAGTGGG - Intronic
1019110790 6:169711587-169711609 GGGGAGCTATGGCATGCAAAGGG - Intronic
1019741272 7:2675705-2675727 GGTTTGCTGTGGCCTCCAGTGGG - Intergenic
1021917973 7:25454841-25454863 TGAGTGTTATGGCATCTAGTGGG - Intergenic
1022822530 7:33975036-33975058 GGGGTTTACTGGCATCCAGTTGG - Intronic
1034002601 7:147432248-147432270 GGGGTGCTATGCCATCTAGTGGG - Intronic
1034011526 7:147534189-147534211 GGGTTGCTATGGTATCTAATGGG + Intronic
1038122847 8:24637543-24637565 GGGGTGATATACCCTCCAGTGGG - Intergenic
1044963521 8:97554187-97554209 AGGGTGCCATGGCATGTAGTGGG - Intergenic
1047426720 8:124753267-124753289 GGGCTGCTATGACACACAGTGGG - Intergenic
1048609330 8:136004855-136004877 GAGGTTCTCTGGCATCCAGGAGG - Intergenic
1049809761 8:144561120-144561142 GGGGTGCAATGGAAACCACTGGG - Intronic
1049809771 8:144561160-144561182 GGGGTGCGATGGAAACCACTGGG - Intronic
1051570718 9:18555625-18555647 AGGGTGCTATGGCATCCCAGAGG + Intronic
1052441357 9:28499875-28499897 GTGCAACTATGGCATCCAGTGGG - Intronic
1053086897 9:35232628-35232650 TGGGTGGTATGCCATTCAGTAGG + Intronic
1056254000 9:84779601-84779623 GGTGTGCTATGTCATGCCGTAGG + Intronic
1060872088 9:127050704-127050726 GGAATGCTATGCCATCCCGTGGG + Intronic
1061209817 9:129184614-129184636 GGGCTGCTGTGGCACACAGTAGG - Intergenic
1061898489 9:133660822-133660844 GGTGTGCTCTGGGACCCAGTCGG - Intergenic
1062694210 9:137864852-137864874 GGAGTGCTATGGCACTTAGTGGG + Intronic
1186323399 X:8453404-8453426 GGGGTGGATTGGCATCTAGTGGG - Intergenic
1186431626 X:9510132-9510154 GGGGTGCTATGGCATTGGGTGGG + Intronic
1186525276 X:10242597-10242619 GGGGTGCGATGGCATCTAGTGGG - Intergenic
1187457751 X:19457853-19457875 GGTGTGCTGTGGCTTCCAGTGGG - Intronic
1193039168 X:76986845-76986867 AGAGTGCTATGAAATCCAGTAGG - Intergenic
1193091199 X:77495037-77495059 GGGCTGCTATGGCTTGCTGTGGG - Intergenic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1195996610 X:110737944-110737966 AGGGTACTCTGGCATCTAGTGGG + Intronic
1199396631 X:147346024-147346046 GGGGTGCAATGGCACCCTGTCGG - Intergenic
1200168114 X:154051205-154051227 GGGGTGGTAGGGCGCCCAGTGGG + Intronic
1202268000 Y:23041056-23041078 GGGGTGTTGTGCCATACAGTTGG + Intergenic
1202420992 Y:24674800-24674822 GGGGTGTTGTGCCATACAGTTGG + Intergenic
1202449794 Y:24995282-24995304 GGGGTGTTGTGCCATACAGTTGG - Intergenic