ID: 1075640221

View in Genome Browser
Species Human (GRCh38)
Location 10:124059438-124059460
Sequence GTCTCTGTGCATTATACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075640221_1075640226 4 Left 1075640221 10:124059438-124059460 CCCAGAGTATAATGCACAGAGAC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1075640226 10:124059465-124059487 GATTAAGGACAGAAGGAGCAGGG No data
1075640221_1075640227 24 Left 1075640221 10:124059438-124059460 CCCAGAGTATAATGCACAGAGAC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1075640227 10:124059485-124059507 GGGTGACTCTGTCCACTCTCAGG No data
1075640221_1075640225 3 Left 1075640221 10:124059438-124059460 CCCAGAGTATAATGCACAGAGAC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1075640225 10:124059464-124059486 AGATTAAGGACAGAAGGAGCAGG No data
1075640221_1075640224 -3 Left 1075640221 10:124059438-124059460 CCCAGAGTATAATGCACAGAGAC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1075640224 10:124059458-124059480 GACTACAGATTAAGGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075640221 Original CRISPR GTCTCTGTGCATTATACTCT GGG (reversed) Intronic
900997927 1:6132620-6132642 GTCTCTGTACATTGCATTCTGGG + Intronic
907818947 1:57947962-57947984 GCTTCTGTGCATTACACTTTGGG + Intronic
910212600 1:84808714-84808736 GATTCTGTGCATTTCACTCTTGG - Intergenic
910283118 1:85523432-85523454 GTCTCTATGCATTAGCATCTTGG + Intronic
911300407 1:96166064-96166086 ACCACTGTGCATTAGACTCTGGG + Intergenic
911538624 1:99131017-99131039 GTCTTTGTGCTTTACATTCTGGG + Intergenic
914206897 1:145539557-145539579 GTCTCTATGCATTAGCATCTTGG - Intergenic
922644459 1:227272779-227272801 TATTCTGTTCATTATACTCTTGG - Intronic
923548289 1:234940862-234940884 GACCCTGTGGATTTTACTCTTGG - Intergenic
1063905577 10:10777115-10777137 GTCTCTCAGCATTGTGCTCTTGG + Intergenic
1071204384 10:83256557-83256579 GACTCTGTGCATTGTACTAATGG + Intergenic
1075446164 10:122514767-122514789 GTCTCTGTGCATTGACCTTTGGG - Exonic
1075640221 10:124059438-124059460 GTCTCTGTGCATTATACTCTGGG - Intronic
1078787604 11:14510113-14510135 GTTACTCTGCATTTTACTCTGGG - Intronic
1079846022 11:25468986-25469008 GTATCTGTGTATTATTTTCTAGG + Intergenic
1080916138 11:36662191-36662213 ACCTCTGTGCATTATTCCCTTGG - Intergenic
1085994552 11:81894849-81894871 CTCTCTGTGCACAATGCTCTTGG - Intergenic
1086453779 11:86942131-86942153 GCCTCTGTGCATTCAACTCTGGG - Intronic
1092341163 12:7677407-7677429 GTTTATGTGCATTATTTTCTGGG + Intergenic
1092895717 12:13008361-13008383 CTCTGTGAGCCTTATACTCTTGG - Intergenic
1094155132 12:27331240-27331262 GTCTCTCTGCCTTATCCTATGGG + Intergenic
1094240901 12:28223386-28223408 TCATCTTTGCATTATACTCTAGG + Intronic
1094387019 12:29905890-29905912 TACTCTGTGCAGTATACTATGGG - Intergenic
1096194362 12:49640160-49640182 GGCTCTTTGCATTATCCTATGGG - Exonic
1096705107 12:53415898-53415920 GTCTTTGTGCCCTAGACTCTAGG - Intronic
1096794648 12:54068262-54068284 GTCTCTGTGCAATCTCCTTTTGG - Intergenic
1103141021 12:118548496-118548518 GTCTCTTGGCTCTATACTCTTGG - Intergenic
1107206314 13:37793572-37793594 GGGACTGTTCATTATACTCTTGG - Intronic
1107448134 13:40486175-40486197 GCCTCTGTGCTTTCTGCTCTGGG - Intergenic
1107987528 13:45788019-45788041 GGCTCTTTGGATTATACCCTTGG - Intronic
1108319576 13:49275469-49275491 GTCTCTGTGTGTTATTCTCCTGG - Intronic
1108773121 13:53729972-53729994 GTCTCTGAGCATGAGACTCTTGG + Intergenic
1109019335 13:57065761-57065783 TCCTCTCTGCATTATATTCTAGG + Intergenic
1110465417 13:75794885-75794907 GTCTCTGAGCAGTTTGCTCTGGG + Intronic
1113724807 13:112590411-112590433 GTTTCCTTGCATTATATTCTGGG - Intergenic
1116528697 14:45938924-45938946 GTTTCTGTTCCTAATACTCTGGG + Intergenic
1118662982 14:68035113-68035135 GTTTCTGTGGATTATACTCATGG + Intronic
1118662984 14:68035136-68035158 ATTTCTGTGGATTATACTCATGG + Intronic
1119020098 14:71103336-71103358 GTTTCTGTGAATTTTATTCTTGG + Intronic
1119773816 14:77236557-77236579 GTCTCTGTGCAGTGGGCTCTGGG + Intronic
1119836302 14:77752875-77752897 GTCTCTCAGCTTTATTCTCTTGG - Intronic
1120090615 14:80328836-80328858 TTCTCTGAGCATAAAACTCTGGG - Intronic
1121620033 14:95340144-95340166 CTCTCTGTGAATTATTTTCTAGG - Intergenic
1129130416 15:73488494-73488516 ATCTCTGAGCAAAATACTCTAGG - Intronic
1132424583 15:101704256-101704278 GTCTTTGTGTATTGTTCTCTAGG + Intronic
1138646081 16:58426054-58426076 GTGTCTTTTCATTTTACTCTTGG - Intergenic
1139228494 16:65256868-65256890 GCCTCTGTGCATTGTACTCAGGG + Intergenic
1144502477 17:15800708-15800730 GTGTTTGTGTATTATACACTGGG - Intergenic
1145164654 17:20603362-20603384 GTGTTTGTGTATTATACACTGGG - Intergenic
1149167669 17:53772819-53772841 GTCTCTATGAATTCTATTCTAGG + Intergenic
1153721452 18:7907496-7907518 GTCTCTGTGCACCTTACCCTTGG + Intronic
1153774074 18:8437501-8437523 TTCTCTGTGCAATGTACTCAGGG - Intergenic
1155236461 18:23824629-23824651 GTCGCTGTGGATTGTAGTCTTGG - Intronic
1156632734 18:38989649-38989671 GTCACTGTGCATTATACGGATGG + Intergenic
1156974903 18:43208687-43208709 ATCTCTGATGATTATACTCTTGG - Intergenic
1157129370 18:44990188-44990210 GTCTTTCTGCAGTATACGCTTGG - Intronic
1158902187 18:61974306-61974328 ATCTCTGTGCATTATCCAATTGG - Intergenic
1159119617 18:64153448-64153470 CTCTCTGTGCATTTTACTGGCGG - Intergenic
1164445233 19:28311724-28311746 GCCTTTGTGCATAATATTCTTGG + Intergenic
927266263 2:21155107-21155129 GTCTCTCTGCATTGCATTCTGGG + Intergenic
928985558 2:37177984-37178006 GTCTCTGGCCACTATACTCATGG + Intronic
929127390 2:38534306-38534328 TTCCCTATGCACTATACTCTGGG - Intergenic
932022674 2:68103586-68103608 GTCTGTTTTCATTATACCCTTGG - Intronic
932559112 2:72851614-72851636 GTCTCTGTGAATTGTCCTCTTGG + Intergenic
933424201 2:82089014-82089036 GGCACTGTACATGATACTCTAGG - Intergenic
935317080 2:101845564-101845586 GTTACTGTGCCTTATACTGTAGG + Intronic
935436283 2:103037867-103037889 GTCTCTCTGCATAGTATTCTTGG + Intergenic
936669185 2:114636583-114636605 GGCTCTGTGGACTATACTCTGGG + Intronic
937607781 2:123822682-123822704 ATCTCTGGGCTTTATACTTTGGG - Intergenic
945168574 2:206971987-206972009 GGCTCTTTGCATCATCCTCTTGG - Intergenic
945358689 2:208869343-208869365 TTCTCTGTTCATTATATTATAGG - Intergenic
947111057 2:226720247-226720269 GTGTCTGTGCATTATAGTAGAGG - Intergenic
947931647 2:233969760-233969782 GTGTCTGTTTATTATACCCTTGG + Exonic
1170071801 20:12377365-12377387 TTCTCTGTGCATGATAATGTTGG - Intergenic
1174197081 20:48780943-48780965 CTCTCTGTGCATTTTAATCAGGG - Intronic
1175615626 20:60395797-60395819 GTCTCTGTACATTACCATCTGGG + Intergenic
1178121082 21:29470876-29470898 GTCTCTGTGCATAATTCTCCTGG + Intronic
1182107881 22:27702175-27702197 GGCTCTGTGCCTTCTGCTCTTGG - Intergenic
1182358692 22:29734391-29734413 CTCTCTGTGCCTTGTACTCTGGG + Intronic
1182785627 22:32905389-32905411 GACTCTTTGCCTTATGCTCTGGG - Intronic
1183849181 22:40569826-40569848 GTCTCTCTGCCCTATACCCTGGG + Intronic
1184861940 22:47177230-47177252 GTCTCTGTGGTTTGTACTTTTGG + Intergenic
1185054572 22:48572458-48572480 GTTTTTGTGCATTTCACTCTTGG + Intronic
950663012 3:14478346-14478368 GTCTTTGTCCATTTTTCTCTTGG + Intronic
952036667 3:29211067-29211089 TTTTCTGTGCATAATACACTAGG + Intergenic
952474812 3:33697390-33697412 GTTACTGTGCAAAATACTCTAGG + Intronic
955877707 3:63510792-63510814 GTCTCAGTTCTTTATGCTCTGGG + Intronic
955934879 3:64093073-64093095 GTCTCTATGAATTTGACTCTAGG + Intergenic
960648559 3:119919459-119919481 GGCTCTGGGCATTATTCTTTGGG - Intronic
961905949 3:130263683-130263705 GTCTCTGAGCACTATCCTCCAGG - Intergenic
962226429 3:133614504-133614526 GTCTCTTTGCATTCTAATATTGG + Intronic
964681131 3:159340766-159340788 TTCTGTGTGCATTATAATTTGGG + Intronic
965711104 3:171557419-171557441 GCCACTGTGCATGATACTGTAGG + Intergenic
968677901 4:1894984-1895006 GTCTCTATGTATTCTATTCTGGG + Intronic
970168846 4:13268431-13268453 CTCTCTGTGCATTATCCTGTGGG + Intergenic
971965578 4:33551139-33551161 GTCCATGGGCATTATCCTCTAGG + Intergenic
972578391 4:40373126-40373148 GTCTCTATGAAGTTTACTCTAGG - Intergenic
973681727 4:53327433-53327455 GCCACAGTGCATCATACTCTTGG - Intronic
973990600 4:56403125-56403147 ATCTCTGTGCATTATAAGCAGGG + Exonic
974451633 4:62070492-62070514 TTCTCGGTGGAGTATACTCTTGG - Exonic
976207697 4:82638319-82638341 GTGTCTGGGCAGTTTACTCTGGG + Intronic
976850324 4:89537436-89537458 CTCTCTATTCATTATACTTTTGG + Intergenic
977035975 4:91954187-91954209 TTCTCTTTGGATTATACTTTTGG + Intergenic
977302842 4:95287721-95287743 GTTTCTGTGCAGTGAACTCTAGG - Intronic
981939432 4:150266343-150266365 GTCTATGTCCATCATGCTCTGGG + Intronic
984626808 4:182016501-182016523 GTCTGTGTGCATTTTCCCCTTGG + Intergenic
989422369 5:41254961-41254983 GCACCTATGCATTATACTCTGGG - Intronic
989713378 5:44428804-44428826 GATTCTGTGCAATATACTCCAGG + Intergenic
996417244 5:123223384-123223406 GTCTCGGTGCATCTTACTATTGG + Intergenic
998989402 5:147799215-147799237 ATGTCTGTTCATTCTACTCTTGG - Intergenic
1005127821 6:22468863-22468885 GTTTCTGTACAGTATAGTCTTGG + Intergenic
1006163600 6:32051868-32051890 GTCTCTATGAATTTGACTCTAGG - Intronic
1008743515 6:54639906-54639928 TTTGCTCTGCATTATACTCTTGG - Intergenic
1012888191 6:104868740-104868762 CTCTCTGTGCATTATATTTATGG + Intergenic
1013185407 6:107753410-107753432 GTCTCTATGCATTTGACTTTTGG - Intronic
1014986084 6:128011842-128011864 GTCTCAATGCTTTGTACTCTTGG - Intronic
1015285718 6:131484918-131484940 GTCTCTGTGCAGTTTTCTCATGG + Intergenic
1018280646 6:162181791-162181813 GTGTCTGTGCACTTTTCTCTTGG - Intronic
1019087790 6:169498193-169498215 GTCTCTGTGATTTTCACTCTAGG - Intronic
1020432525 7:8128365-8128387 GTTTCTGGGCATCAGACTCTAGG + Intronic
1020520207 7:9175756-9175778 GTCTCTGTTCACTATACTTCAGG - Intergenic
1026926122 7:74195164-74195186 GTCTCTGTGCTCTTTCCTCTGGG - Exonic
1027359971 7:77398141-77398163 GTCTCTTTCCCTTATCCTCTGGG - Intronic
1030180788 7:106706884-106706906 GTATCTGTTCATTTTTCTCTTGG + Intergenic
1031074703 7:117201276-117201298 GTTTCTGTTCATTTTCCTCTGGG - Intronic
1031972773 7:128076031-128076053 GCCTCTGGGCGTTAGACTCTGGG - Intronic
1032887863 7:136161894-136161916 GTCTATGTTCATTATGCTCATGG + Intergenic
1033453085 7:141478925-141478947 AGCTCTGTGCTTTCTACTCTAGG - Exonic
1041775740 8:61520973-61520995 TTCTCTGTGCAGTAGACTCTGGG + Intronic
1045054415 8:98357079-98357101 GTCTTTGTGCTTTTTATTCTGGG + Intergenic
1048295097 8:133208371-133208393 GTCACTGTTCATGTTACTCTGGG - Intronic
1048767887 8:137863823-137863845 GTAACTTTGCATTATCCTCTAGG + Intergenic
1048818001 8:138352060-138352082 TGCTCTGTGCATAATACTCTAGG + Intronic
1053117637 9:35519536-35519558 GTCTGTGGCCATCATACTCTAGG - Intronic
1057496929 9:95568697-95568719 CTCGCTGTGCATTATCCACTCGG - Intergenic
1058373187 9:104293648-104293670 GTCTCACTGCATTATAATCATGG + Intergenic
1059965800 9:119612197-119612219 GTGACTTTGCATTCTACTCTTGG - Intergenic
1188250897 X:27892845-27892867 GTCTCTGGGATTTATAATCTGGG + Intergenic
1188438708 X:30193109-30193131 GTATGTGTGCATTTTCCTCTGGG + Intergenic
1195295757 X:103474779-103474801 TTATATCTGCATTATACTCTAGG + Intergenic