ID: 1075640222

View in Genome Browser
Species Human (GRCh38)
Location 10:124059439-124059461
Sequence AGTCTCTGTGCATTATACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075640222_1075640226 3 Left 1075640222 10:124059439-124059461 CCAGAGTATAATGCACAGAGACT 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1075640226 10:124059465-124059487 GATTAAGGACAGAAGGAGCAGGG No data
1075640222_1075640225 2 Left 1075640222 10:124059439-124059461 CCAGAGTATAATGCACAGAGACT 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1075640225 10:124059464-124059486 AGATTAAGGACAGAAGGAGCAGG No data
1075640222_1075640224 -4 Left 1075640222 10:124059439-124059461 CCAGAGTATAATGCACAGAGACT 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1075640224 10:124059458-124059480 GACTACAGATTAAGGACAGAAGG No data
1075640222_1075640227 23 Left 1075640222 10:124059439-124059461 CCAGAGTATAATGCACAGAGACT 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1075640227 10:124059485-124059507 GGGTGACTCTGTCCACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075640222 Original CRISPR AGTCTCTGTGCATTATACTC TGG (reversed) Intronic
907818946 1:57947961-57947983 AGCTTCTGTGCATTACACTTTGG + Intronic
911300406 1:96166063-96166085 AACCACTGTGCATTAGACTCTGG + Intergenic
912074841 1:105861038-105861060 AGTCTCTGAACATTTTACTAAGG + Intergenic
920235595 1:204501745-204501767 AGACTCTATGCACTATACTGTGG + Intergenic
923959903 1:239068022-239068044 AAGCTCTGTTCATTATCCTCAGG + Intergenic
1063170994 10:3509888-3509910 AGCCACAGTGCATTATTCTCAGG + Intergenic
1075640222 10:124059439-124059461 AGTCTCTGTGCATTATACTCTGG - Intronic
1076366601 10:129925221-129925243 AGGCTCTGTGCATCATTCTCAGG - Intronic
1080875262 11:36269124-36269146 AGTATTTGTGCATTTTACTGAGG - Intergenic
1081263547 11:40990494-40990516 AGACTCTGTGCATTAATCACTGG + Intronic
1082212622 11:49523724-49523746 AGTTTCTCTTCATTATACCCAGG - Intergenic
1086410272 11:86538067-86538089 AGTCTATGTGCATCAGTCTCAGG - Intronic
1086453780 11:86942132-86942154 AGCCTCTGTGCATTCAACTCTGG - Intronic
1086636971 11:89100787-89100809 AGTTTCTCTTCATTATACCCAGG + Intergenic
1086803578 11:91209889-91209911 AGTCTGTTTGCATTCCACTCTGG - Intergenic
1088249296 11:107848916-107848938 AATCTCACTGCATTATGCTCAGG - Intronic
1089859759 11:121578509-121578531 AATAACTGTGCATTATGCTCTGG + Intronic
1092051874 12:5476874-5476896 AATCTCTATGCATTATAGGCGGG - Intronic
1093576140 12:20732247-20732269 AGTCTCTTTGCATTCAAATCTGG + Intronic
1095303918 12:40618909-40618931 ACTCTCTCTGCAATATACCCAGG + Intergenic
1098829554 12:75343917-75343939 AGTCTGTGGCCATTATACACAGG + Exonic
1104732147 12:131113221-131113243 AGTCTCTGTACATTTTCCTAAGG - Intronic
1110465416 13:75794884-75794906 AGTCTCTGAGCAGTTTGCTCTGG + Intronic
1111823990 13:93245616-93245638 AGTCTCTGGGGCTCATACTCTGG + Intronic
1111860599 13:93700190-93700212 AGTTTCTGTGTTTTATACTGAGG + Intronic
1112989694 13:105497104-105497126 AGTCTCTGTGTTTTCTACCCGGG - Intergenic
1113572425 13:111368179-111368201 AGCCTCTGTGCACTGCACTCAGG - Intergenic
1114909746 14:27175647-27175669 AGTCTCTGTGAATTATTCCAGGG + Intergenic
1116876792 14:50120183-50120205 AGAGTCTGTGAATTATACTTTGG - Intronic
1129929252 15:79395793-79395815 AGTCTGTGTGTAATAGACTCAGG + Intronic
1133682769 16:8135907-8135929 AGTCTCTCTGCAGTTTACTGGGG - Intergenic
1136899653 16:34021159-34021181 AGTCTCTTTGTATGTTACTCAGG - Intergenic
1138121934 16:54407404-54407426 AGTCTCTGTCCATGATACAGAGG - Intergenic
1139228493 16:65256867-65256889 AGCCTCTGTGCATTGTACTCAGG + Intergenic
1141198549 16:81879760-81879782 ATTTTCTGTGCATTGTACACAGG - Intronic
1141304165 16:82845385-82845407 AGTCTCTTTGCATTCTGCTTTGG - Intronic
1144502478 17:15800709-15800731 AGTGTTTGTGTATTATACACTGG - Intergenic
1145164655 17:20603363-20603385 AGTGTTTGTGTATTATACACTGG - Intergenic
1150897831 17:69234599-69234621 AGTCTCTGTGCAGGAGCCTCAGG - Intronic
1151303316 17:73244996-73245018 AGTCTCTGTTCATTAATGTCAGG - Intronic
1153132082 18:1865799-1865821 GTTCTCTGTGTGTTATACTCTGG - Intergenic
1153774075 18:8437502-8437524 TTTCTCTGTGCAATGTACTCAGG - Intergenic
926386032 2:12336663-12336685 AGTCTCTGTGGATGAAACTCTGG + Intergenic
927266262 2:21155106-21155128 AGTCTCTCTGCATTGCATTCTGG + Intergenic
936027222 2:109042165-109042187 AGTCTCAGAGCATTGCACTCAGG + Intergenic
936669184 2:114636582-114636604 GGGCTCTGTGGACTATACTCTGG + Intronic
938654141 2:133413337-133413359 AATCTGTGTGCATTACAATCTGG - Intronic
947455717 2:230252053-230252075 AGTCTCTTTCCATTAAACCCAGG - Intronic
1169862979 20:10171960-10171982 AGTCTCTGTGCCTCAAACACAGG - Intergenic
1169951846 20:11053340-11053362 ATTCTCTGTGCATAATCCTTTGG + Intergenic
1172169953 20:32923808-32923830 AGACTCTGTGCAGTGTACCCAGG - Intronic
1173972064 20:47160861-47160883 AGTCTCTGTGCAGAGGACTCAGG - Intronic
1174197082 20:48780944-48780966 CCTCTCTGTGCATTTTAATCAGG - Intronic
1175343501 20:58251267-58251289 GGTCTCTGTTCATGATACACAGG - Intergenic
1180658807 22:17447629-17447651 AGTCTCTGGGCATGGGACTCAGG - Intronic
1180946521 22:19696787-19696809 AGTCTCTGTGCATAGTGCTCTGG - Intergenic
1182358691 22:29734390-29734412 GCTCTCTGTGCCTTGTACTCTGG + Intronic
1182785628 22:32905390-32905412 AGACTCTTTGCCTTATGCTCTGG - Intronic
1183849180 22:40569825-40569847 AGTCTCTCTGCCCTATACCCTGG + Intronic
955129797 3:56154511-56154533 TGTCTCTGTGCATATTACTAAGG + Intronic
955452411 3:59083669-59083691 ATTCTCTATGCATTATTCTCTGG + Intergenic
955877706 3:63510791-63510813 AGTCTCAGTTCTTTATGCTCTGG + Intronic
956107192 3:65832266-65832288 AGTCTTTGTGCCTTATAATTTGG + Intronic
957873844 3:86119601-86119623 AGACTCTGTGCTGGATACTCAGG + Intergenic
959363136 3:105420766-105420788 AATCTCTGTGCATTATAATTAGG - Intronic
960786091 3:121373836-121373858 AGTCTCTGTGCACTCCACTCAGG + Intronic
963637114 3:147811759-147811781 TGTCTCTGAGCATATTACTCTGG - Intergenic
966252618 3:177883568-177883590 AGTCTCTGAGGGTTAAACTCAGG - Intergenic
966371565 3:179255523-179255545 AATCTCTCTGTATTATACTCTGG - Intronic
970168845 4:13268430-13268452 GCTCTCTGTGCATTATCCTGTGG + Intergenic
973990599 4:56403124-56403146 CATCTCTGTGCATTATAAGCAGG + Exonic
980622375 4:135324833-135324855 AGTCTCTGTGCAGTTTCTTCAGG - Intergenic
980892489 4:138830385-138830407 AGACACTGTGCAATAGACTCTGG - Intergenic
981939431 4:150266342-150266364 AGTCTATGTCCATCATGCTCTGG + Intronic
983288984 4:165777300-165777322 TGTCCCTCTGCATTATATTCTGG + Intergenic
985123376 4:186666306-186666328 AGTGTGTGTGCATTATGCTTGGG - Intronic
988292453 5:29305981-29306003 AGTCACTGTGCTTTATATTTAGG + Intergenic
989422370 5:41254962-41254984 AGCACCTATGCATTATACTCTGG - Intronic
990048778 5:51468959-51468981 GGTCCCTGTGCAATTTACTCTGG + Intergenic
992030146 5:72712965-72712987 AATCTCTGTGTATTATACTGTGG - Intergenic
995932471 5:117464373-117464395 AGTGTCCTTGCATTGTACTCTGG + Intergenic
997080691 5:130734463-130734485 AGTCTCTTTGCAGGTTACTCAGG - Intergenic
1000531426 5:162425873-162425895 AGTCTTTGTTCTTTATACTTTGG + Intergenic
1002984136 6:2171757-2171779 AGTCTTTGTGCATTTTAATGTGG - Intronic
1007669330 6:43538845-43538867 AGTCTCTGTGCAGCAGACCCAGG - Intronic
1010023750 6:71191828-71191850 AGTTTTGGTGCATTATAATCAGG - Intergenic
1010082389 6:71879138-71879160 AGCCTCTGTGCATTCTTTTCAGG - Intergenic
1024542034 7:50483537-50483559 GCTCTCTGTGAATTATACTTAGG + Intronic
1030695245 7:112577984-112578006 AGTCTATGTGGATAATTCTCAGG - Intergenic
1031188489 7:118514757-118514779 AGTCTCTGTCAATAATTCTCAGG - Intergenic
1031572405 7:123375588-123375610 AGTCTTTGTACATTATACCATGG + Intergenic
1031802998 7:126272932-126272954 TGTCTTTTTGCATTATACTGTGG - Intergenic
1036004971 8:4651973-4651995 AGTCTCCTTTCATTATACTTAGG - Intronic
1038481358 8:27903982-27904004 AGACTCTGTTCATTCTTCTCTGG + Intronic
1039148175 8:34473384-34473406 AGTATTGGTGCATAATACTCAGG + Intergenic
1040910773 8:52516434-52516456 AGGCTCTCTGGATTATAATCTGG + Intergenic
1041670250 8:60484509-60484531 AGACTCTGTGCTGGATACTCAGG + Intergenic
1041775739 8:61520972-61520994 ATTCTCTGTGCAGTAGACTCTGG + Intronic
1043560663 8:81489788-81489810 AGTCACTGTGCTTGATGCTCTGG + Intergenic
1045054414 8:98357078-98357100 AGTCTTTGTGCTTTTTATTCTGG + Intergenic
1046324695 8:112626285-112626307 AGTAACAGTGCATTATACTGAGG - Intronic
1047401117 8:124548313-124548335 ATTCTTTGTGCATTATAATTGGG + Intronic
1050955761 9:11657334-11657356 AATCTCTGTGCATAATAAACTGG - Intergenic
1052531063 9:29684875-29684897 AGTCTGTATTTATTATACTCTGG - Intergenic
1053026948 9:34738017-34738039 AGTCTCTCTGCATAATCTTCTGG - Intergenic
1058111509 9:101035330-101035352 TGTGTCTTTGCATTATACTCTGG + Intronic
1058336429 9:103835052-103835074 GGTCTCTGTCCATCATACTAAGG + Intergenic
1061500875 9:131001206-131001228 AGTTTCTGTGCATCGTTCTCAGG + Intergenic
1186009465 X:5113262-5113284 ATTCGCTGTGCATTATACACAGG - Intergenic
1188438707 X:30193108-30193130 AGTATGTGTGCATTTTCCTCTGG + Intergenic
1188518463 X:31012610-31012632 ATTCTCTGTGCTTGATTCTCTGG + Intergenic
1188911664 X:35855750-35855772 TGTATATGTGCATTAAACTCGGG - Intergenic
1190222495 X:48521447-48521469 AGTTTCGTTGCATTATACTAAGG + Exonic
1190456581 X:50633863-50633885 AGTGGCTGTGAATTATGCTCTGG + Exonic
1195197150 X:102510002-102510024 AGTCTCTTTGCTTTACACTGGGG - Intergenic
1195643931 X:107207354-107207376 AGTCTCTGCACAGTACACTCGGG - Exonic
1198139033 X:133784357-133784379 TGCCTCTCTGCATGATACTCAGG - Intronic