ID: 1075640226

View in Genome Browser
Species Human (GRCh38)
Location 10:124059465-124059487
Sequence GATTAAGGACAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075640221_1075640226 4 Left 1075640221 10:124059438-124059460 CCCAGAGTATAATGCACAGAGAC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1075640226 10:124059465-124059487 GATTAAGGACAGAAGGAGCAGGG No data
1075640222_1075640226 3 Left 1075640222 10:124059439-124059461 CCAGAGTATAATGCACAGAGACT 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1075640226 10:124059465-124059487 GATTAAGGACAGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075640226 Original CRISPR GATTAAGGACAGAAGGAGCA GGG Intronic
No off target data available for this crispr