ID: 1075645191

View in Genome Browser
Species Human (GRCh38)
Location 10:124092416-124092438
Sequence CGCCGCCTCCCGAGACGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075645187_1075645191 -5 Left 1075645187 10:124092398-124092420 CCGGCAACTCCCGAGTCACGCCG 0: 1
1: 0
2: 0
3: 5
4: 25
Right 1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 136
1075645178_1075645191 27 Left 1075645178 10:124092366-124092388 CCGGCCAGAGACGCCGCCACCGC 0: 1
1: 1
2: 3
3: 13
4: 211
Right 1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 136
1075645184_1075645191 11 Left 1075645184 10:124092382-124092404 CCACCGCCGGGAAGCGCCGGCAA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 136
1075645185_1075645191 8 Left 1075645185 10:124092385-124092407 CCGCCGGGAAGCGCCGGCAACTC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 136
1075645182_1075645191 14 Left 1075645182 10:124092379-124092401 CCGCCACCGCCGGGAAGCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 136
1075645180_1075645191 23 Left 1075645180 10:124092370-124092392 CCAGAGACGCCGCCACCGCCGGG 0: 1
1: 0
2: 2
3: 42
4: 269
Right 1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 136
1075645186_1075645191 5 Left 1075645186 10:124092388-124092410 CCGGGAAGCGCCGGCAACTCCCG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075645191 Original CRISPR CGCCGCCTCCCGAGACGCGG CGG Intronic
900100592 1:960521-960543 CCCCGCCTCCCGAGAGGCTTCGG - Intergenic
900227726 1:1540693-1540715 CGGTCCCTCCCGAGAGGCGGAGG - Intergenic
900511549 1:3063226-3063248 GGCCGCCTCCAGAGCCGCCGTGG + Intergenic
901630905 1:10647744-10647766 CACCTACTCCCGAGACGCGAGGG + Intronic
902323721 1:15684715-15684737 CGTCGCCCCCCGGGTCGCGGAGG - Intronic
902856552 1:19210298-19210320 CGCCGCCTCCCAGGAGGGGGCGG + Intergenic
903259077 1:22121560-22121582 GGCCGCCTCCCGAGTCCCTGTGG + Exonic
905376928 1:37528394-37528416 CGCAGCCTCCCGAGTAGCCGGGG + Intergenic
906182485 1:43834042-43834064 CTCAGCCTCCCGAGAAGCTGAGG - Intronic
908501273 1:64745443-64745465 CGACGCGTCCCGAGGGGCGGCGG + Intronic
916224565 1:162476419-162476441 CGCAGCCTCCCGAGTAGCTGGGG + Intergenic
916433142 1:164751696-164751718 CTCCGCCTCCCGAGTAGCTGGGG + Intronic
920950696 1:210569255-210569277 CTCAGCCTCCCGAGTCGCTGGGG - Intronic
924415072 1:243850069-243850091 CGCCGCCGCCCGAGCAGCTGCGG - Intronic
1062774755 10:135644-135666 CGCCGCCGCCCCAGAGGCCGCGG - Intronic
1063407866 10:5813661-5813683 CGCCGCCTCCCGAACCACCGTGG - Intronic
1064110039 10:12530642-12530664 CGCTGCCTCCCCAGACCCCGAGG - Intronic
1064384658 10:14879197-14879219 GGCCGCCACGGGAGACGCGGAGG - Intronic
1064672478 10:17730976-17730998 CTCCACCTCCCCAGAAGCGGTGG + Intergenic
1065363339 10:24910042-24910064 CTCAGCCTCCCGAGAAGCTGGGG - Intronic
1065526085 10:26622532-26622554 CGGCGGCTCCCGGGAGGCGGCGG - Intergenic
1066402616 10:35090366-35090388 CACCGGCCCCGGAGACGCGGGGG + Intronic
1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG + Exonic
1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG + Intronic
1076722033 10:132397006-132397028 CGGCTTCTCCCGGGACGCGGCGG + Intergenic
1083442721 11:62687800-62687822 AGCCGCCGCCCGAGCCGCAGGGG - Exonic
1083747804 11:64745088-64745110 CCCCGCCGCCCGGGACGCGGAGG + Intronic
1084171074 11:67401385-67401407 AGTCGCCTCCCGAGGCGCTGAGG - Intronic
1088256498 11:107908395-107908417 CGCCGCCGCCGCAGACGCCGCGG + Intronic
1091211539 11:133864992-133865014 CGACGGCTCCCGGGACCCGGCGG - Intergenic
1092290570 12:7157583-7157605 CGCCGGCCCCTGAGACGCGGCGG - Exonic
1095349149 12:41188783-41188805 CGCCGGCTCCGCAGCCGCGGGGG + Exonic
1098420624 12:70293275-70293297 CTCCGCCTCCCGAGTAGCTGGGG + Intronic
1103642554 12:122363645-122363667 CGCCCCCTCCCCAGACGCCCAGG + Intronic
1107120580 13:36791098-36791120 CTCCGCCTCCCGGGAGGTGGAGG + Intergenic
1117028990 14:51651018-51651040 CGCCCCCTCCCCAGACCCCGAGG + Intronic
1119248403 14:73132234-73132256 CTCAGCCTCCCGAGAAGCTGGGG - Intergenic
1122657679 14:103273346-103273368 CGCCCCCGCCCGATCCGCGGAGG + Intergenic
1122759064 14:104007394-104007416 AGCGGCCTCCCGAGAAGCGATGG - Intronic
1124038951 15:26082553-26082575 TGCCGCCTCCCGCGAGCCGGGGG - Intergenic
1130390186 15:83447849-83447871 CTCCGCCTCCCGAGTCCCCGCGG - Intronic
1130963170 15:88678434-88678456 CTCAGCCTCCCGAGAAGCTGGGG - Intergenic
1131272407 15:90955240-90955262 CGTCGCCGCCCGGGGCGCGGCGG - Intronic
1132994814 16:2817424-2817446 CGCCGCCTCCTGCGACTCTGCGG - Exonic
1139954402 16:70686274-70686296 CGCCGCCCCCCGACCCTCGGTGG - Intergenic
1141633905 16:85303720-85303742 CGCCGCCTCCCGAGTTCTGGGGG + Intergenic
1141828617 16:86497513-86497535 CGCCGCCTCCGGAGCCCCGACGG + Intergenic
1142286030 16:89171902-89171924 CGCTGCCTCCCTCGACGCTGCGG + Intronic
1142389597 16:89790275-89790297 CTCCGCCTCCCGAGTAGCTGGGG - Intronic
1146052996 17:29567434-29567456 CGCCGGCTCCCGGGACCCCGTGG + Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147629231 17:41919162-41919184 CGCAGGCTCCCAAGAGGCGGTGG - Intronic
1148437140 17:47693898-47693920 CGCCGCCTCTCGCCACGTGGTGG + Intergenic
1148615790 17:48998534-48998556 TGCTGCTTCCCGAGACGCCGAGG + Intronic
1148767943 17:50050166-50050188 CGCAGCCTCCCGAGTAGCTGGGG - Intergenic
1148871302 17:50660188-50660210 CGCCGCCTCCAGACAGGAGGAGG - Intronic
1149430723 17:56594120-56594142 AGCCGCCTCCGGAGAGACGGGGG + Exonic
1150302501 17:64057931-64057953 CTCCACATCCCGAGACACGGTGG + Exonic
1150416907 17:64995405-64995427 CGCAGCCTCCCGAGGAGGGGAGG + Intergenic
1152628125 17:81397579-81397601 CGGCGCCTCCCGAGCCCCGGAGG - Intronic
1153855153 18:9137383-9137405 CGCCGCCTCCCGGAACATGGCGG + Intronic
1157596164 18:48865128-48865150 CGCAGCCTGCCGAGTCCCGGGGG - Intergenic
1158479248 18:57805672-57805694 CGCAGCCTCCCGAGTAGCTGGGG + Intergenic
1158976515 18:62715793-62715815 CGCCGCCGCCAGAGCCGCCGCGG - Exonic
1159414381 18:68125155-68125177 CTCAGCCTCCCGAGTAGCGGGGG + Intergenic
1162393484 19:10403499-10403521 CGCCGCCACCCGAGCCGGAGCGG - Exonic
1163453239 19:17391225-17391247 CGCCGCCTCCCGGGCCGCACAGG + Intergenic
1164690240 19:30205461-30205483 CTCCGCCTCCCGAGTAGCTGGGG - Intergenic
1168234493 19:55053538-55053560 CTCAGCCTCCCGAGTGGCGGGGG - Intronic
1168360289 19:55734037-55734059 CGCAGCCTCCCGAGTAGCTGGGG + Intronic
1168528102 19:57104800-57104822 CGCAGCCTCCCGAGTAGCTGGGG + Intergenic
926095828 2:10080232-10080254 CGCCGCCTCCCGGACCGCCGAGG + Exonic
934296831 2:91749081-91749103 CGCCGCCACCAGCGCCGCGGCGG + Intergenic
939463404 2:142526805-142526827 CTCAGCCTCCCGAGTAGCGGGGG - Intergenic
941808586 2:169734062-169734084 CGCCGCGTCCCGAGCCCCGGCGG + Exonic
942030130 2:171950924-171950946 CTCAGCCTCCCGAGTCGCTGGGG + Intronic
944238697 2:197465000-197465022 CTCAGCCTCCCGAGTAGCGGGGG + Intronic
947119170 2:226798874-226798896 CGCCGCCCCCCGCGCCGGGGAGG + Exonic
949059925 2:241950944-241950966 AGCTGCCTCCCGAGACGGTGAGG - Intergenic
1170228055 20:14013797-14013819 CTCAGCCTCCCGAGTCGCTGGGG + Intronic
1180228357 21:46411814-46411836 CGGCGCCTCCCGAGCTGCAGTGG + Exonic
1183720192 22:39557903-39557925 CGCCGCCCCCCGCGCCCCGGGGG + Intergenic
1185278831 22:49961301-49961323 AGCCACCTGCGGAGACGCGGGGG - Exonic
950683743 3:14602492-14602514 GGCCACCTCCCGACACCCGGCGG + Intergenic
953362103 3:42306614-42306636 CACCGCCTCCCCAGATGAGGAGG - Intergenic
954063531 3:48088622-48088644 CGCCGGCCTGCGAGACGCGGGGG - Intronic
954158031 3:48698584-48698606 CTCAGCCTCCCGAGAAGCTGAGG + Intronic
954871351 3:53769655-53769677 AGCCTCCTCGCGAGAAGCGGGGG + Intronic
961573671 3:127818075-127818097 CTCAGCCTCCCGAGTAGCGGGGG + Intronic
962761863 3:138521688-138521710 CCCCACCCCCCGAGACGGGGCGG - Intronic
963128780 3:141839203-141839225 CTCAGCCTCCCGAGTAGCGGGGG + Intergenic
966732644 3:183163405-183163427 CGCAGCCTCCCGAGTAGCTGGGG + Intronic
968915769 4:3496532-3496554 CGCCCCCTCCCCAGATGCCGAGG + Intronic
968944101 4:3654594-3654616 CGCTGCCTTCCCAGACGCTGCGG - Intergenic
969722337 4:8899321-8899343 CTCAGCCTCCCGAGAAGCTGAGG + Intergenic
972396518 4:38663730-38663752 CGCCGCCGCCCGAGCCCGGGGGG - Intergenic
975118673 4:70705509-70705531 CGCGGCCTGGGGAGACGCGGAGG - Intronic
985006004 4:185535657-185535679 GGCAGCCTCCCGGGCCGCGGCGG + Intergenic
985652152 5:1112204-1112226 CCCCGCGTCCCGGGTCGCGGCGG - Intergenic
987469090 5:18308612-18308634 CTCAGCCTCCCGAGAAGCTGAGG - Intergenic
997470742 5:134115485-134115507 TGCCGCCTCCTGAGCTGCGGTGG - Intronic
998176206 5:139903787-139903809 CGCCAACTCCGGAGACTCGGAGG - Intronic
1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG + Exonic
1004087921 6:12470011-12470033 CTCAGCCTCCCGAGAAGCTGGGG - Intergenic
1004394332 6:15235017-15235039 CTCAGCCTCCCGAGCAGCGGGGG + Intergenic
1006932547 6:37696842-37696864 CGGCGCAGCCCGAGAGGCGGCGG + Exonic
1006950698 6:37819535-37819557 CGCCGGCTCCGGAGTCGCAGCGG - Exonic
1007521389 6:42453363-42453385 CGCCCCCGCCCGCGCCGCGGAGG - Intergenic
1012237677 6:96837500-96837522 CGCCGCCTCGCGAGCCGCCGAGG + Intergenic
1016947357 6:149547053-149547075 CTCCGCCTCCCGAGTTGCTGGGG + Intergenic
1016982199 6:149863953-149863975 CGCAGCGCCCCGTGACGCGGCGG + Exonic
1017529044 6:155269436-155269458 CTCAGCCTCCCGAGAAGCTGGGG + Intronic
1019924558 7:4183516-4183538 CTCCGCCTCCCGAGTAGCTGGGG - Intronic
1021442416 7:20691267-20691289 CTCCGCCTCCCGAAACTCAGTGG + Intronic
1021465665 7:20940509-20940531 CTCAGCCTCCCGAGAAGCTGGGG - Intergenic
1021958776 7:25852513-25852535 GGCCGCCTCCGGCGAGGCGGCGG - Intergenic
1024580096 7:50793769-50793791 CGAAGCCTCCTGAGCCGCGGCGG - Intergenic
1026182681 7:68055906-68055928 CTCAGCCTCCCAAGTCGCGGGGG + Intergenic
1027001278 7:74656680-74656702 CGCCACCTACCGAGAAGCGGCGG + Intergenic
1027121799 7:75527591-75527613 CCCCGGCTCCCGAGAGGCCGGGG + Intergenic
1029227139 7:99036359-99036381 CTCCGCCTCCCGAGTAGCTGAGG - Intronic
1029435446 7:100561742-100561764 GGCGGCCTCCCGAGAAGCAGCGG + Intronic
1032011949 7:128352533-128352555 GGCAGCCTCCCGAGGCGCCGAGG - Exonic
1034470511 7:151252032-151252054 CGCCGCCTCCCCGGCCGCCGCGG - Intronic
1036930510 8:12951675-12951697 CGCCGCCTCCCGAAAGGTGAAGG + Intronic
1038789715 8:30657882-30657904 CTCAGCCTCCCGGGAGGCGGCGG + Intronic
1041107589 8:54458072-54458094 CGCCGCCTCCCCCGACCCGGGGG - Exonic
1043296208 8:78666283-78666305 CCCAGCCTCCGGAGGCGCGGCGG - Intronic
1045432163 8:102124196-102124218 CTCTGGCTCCCGAGAAGCGGAGG + Intronic
1045516500 8:102864484-102864506 CGCAGGCGCCCGAGAGGCGGCGG - Exonic
1049688753 8:143949742-143949764 GGCCGCCTCCCTTGCCGCGGGGG - Intronic
1050517081 9:6455865-6455887 CTCAGCCTCCCAAGAAGCGGGGG - Intronic
1051896052 9:21990087-21990109 CGCCGCCTCCGGAGCCACGCTGG - Intronic
1055031450 9:71774456-71774478 CGCAGCCTCCCGAGTAGCTGGGG + Intronic
1055504607 9:76935114-76935136 CTCAGCCTCCCAAGACGCTGGGG + Intergenic
1060184930 9:121558516-121558538 CACCGCCTCCCTAAATGCGGGGG + Intergenic
1061129859 9:128702769-128702791 CGCCCCCTCCCGAGACCCGCTGG - Exonic
1061285481 9:129620230-129620252 CGCCGATTCCCGGGACGCGCCGG + Exonic
1062084689 9:134642493-134642515 CGCCCCCTCCCCAGACGGGCGGG + Intronic
1062507935 9:136887356-136887378 GGCCGCCTCCCGAGAGGCCATGG - Intronic
1062596274 9:137301319-137301341 CGCCCCCACCCGCGAGGCGGCGG + Exonic
1203654208 Un_KI270752v1:7781-7803 CGCCGCCTCGGGGGACGCCGCGG - Intergenic
1187098198 X:16168227-16168249 CTCAGCCTCCCGAGTCGCTGGGG - Intronic
1188769041 X:34130779-34130801 CGCAGCCTCCCAAGACTCGTCGG - Exonic
1190008041 X:46758886-46758908 CGCCGCCGCCCCAGAGGAGGAGG + Exonic