ID: 1075645479

View in Genome Browser
Species Human (GRCh38)
Location 10:124093368-124093390
Sequence CGGCGCCCCTCCGCGGGTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075645479_1075645484 -7 Left 1075645479 10:124093368-124093390 CCCGAACCCGCGGAGGGGCGCCG 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1075645484 10:124093384-124093406 GGCGCCGGAGCCCCGAGCCCAGG 0: 1
1: 0
2: 4
3: 37
4: 332
1075645479_1075645485 -6 Left 1075645479 10:124093368-124093390 CCCGAACCCGCGGAGGGGCGCCG 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1075645485 10:124093385-124093407 GCGCCGGAGCCCCGAGCCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075645479 Original CRISPR CGGCGCCCCTCCGCGGGTTC GGG (reversed) Intronic
900156816 1:1206474-1206496 CAGCGCCCCACCGGGGGTCCCGG - Exonic
900189146 1:1345965-1345987 CTGTGCCCCTCCCCCGGTTCAGG + Intronic
900237737 1:1600550-1600572 CGGGTCCCCGCCGCGGGTCCAGG - Intergenic
901243065 1:7705707-7705729 CTGCGCTCCTCAGCGGGTGCGGG + Intronic
904253126 1:29238380-29238402 CGGGGCTGCTCCGCGGGCTCCGG + Intronic
905741322 1:40373902-40373924 CGGCGCCCCTTGGCGGGCTTAGG - Exonic
906525526 1:46491089-46491111 CGAAGCCCCTGCGCAGGTTCCGG - Intergenic
906719785 1:47996828-47996850 CGGCGCCCCTCAGCGGGGCGGGG + Exonic
912734403 1:112137287-112137309 CGGAGCCTCTCCTCAGGTTCTGG + Intergenic
919699829 1:200620648-200620670 CTTCGCCCCTCCGCAGGGTCCGG + Exonic
920260301 1:204684449-204684471 CGGGGCCCCTCCCCAGGTTCCGG + Intronic
922768847 1:228171179-228171201 CTGCGCCCCTCAGCGGTATCTGG + Intronic
923506230 1:234608948-234608970 CGTGGCCGCGCCGCGGGTTCGGG + Exonic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1065239859 10:23694678-23694700 CGCCGCTCCTCCGCGGGGTGGGG + Intergenic
1069849613 10:71396713-71396735 CGGCGCCGCTCCCGGGGGTCCGG + Intergenic
1070280389 10:75044050-75044072 CGGCGCCCTGCCCCGGGTCCGGG + Intronic
1072682594 10:97517621-97517643 CGGTGGCCCTCTGCGGGATCAGG + Intronic
1075645479 10:124093368-124093390 CGGCGCCCCTCCGCGGGTTCGGG - Intronic
1076132240 10:128021390-128021412 CCGCCCCCCTCCCCGTGTTCAGG + Intronic
1076878941 10:133230754-133230776 CGCCGCCGCTCCCCGGGGTCCGG + Exonic
1077247514 11:1546796-1546818 CTGCGCTCCGCCTCGGGTTCGGG + Intergenic
1081873115 11:46392062-46392084 CGGCGCCCCCTCGCGGGCTGGGG + Intergenic
1087832182 11:102831536-102831558 TGGCGCCCCTCCGCGGCCACGGG - Intergenic
1087962264 11:104366533-104366555 CGGAGCGCCAGCGCGGGTTCCGG - Intergenic
1090716524 11:129436674-129436696 CAGCGGCCCTCCGCAGGTCCTGG + Intronic
1096498263 12:52051038-52051060 CAGCGCCCCTTCTCGGGCTCTGG + Intronic
1096791483 12:54047704-54047726 CGAAGCCCCTCCGCGCGCTCTGG - Intronic
1102518130 12:113463620-113463642 CGGGTCCCCTCCCCGGGTCCCGG - Intronic
1105890929 13:24681482-24681504 GAGCGCCCCTCTGCGGGGTCAGG - Intronic
1106242335 13:27921623-27921645 CAGCGCCCATCTGCGGGGTCTGG + Intronic
1114341573 14:21750868-21750890 CGGCGCCCCTGCGCCGGATACGG - Intergenic
1117135503 14:52730710-52730732 CGCTGCCCCTCCGCGGGGTCTGG - Intronic
1119349144 14:73949977-73949999 CGGCTCCCCTCCGCGCCTCCGGG + Exonic
1120993211 14:90396845-90396867 CGGCGGCCCTACGCTGGGTCGGG - Intronic
1128456543 15:67834642-67834664 GGGAGCCGCCCCGCGGGTTCTGG + Intergenic
1128778939 15:70345200-70345222 CAGCGACCCTCTGCAGGTTCTGG - Intergenic
1129334315 15:74843260-74843282 CGGCGCCCCTCCCCTGTCTCTGG + Intronic
1132881371 16:2163109-2163131 CGTGGCCCCTCCGTGGGTGCTGG - Intronic
1133040940 16:3059430-3059452 CCCCGCCCCTCCCCGGGCTCGGG - Exonic
1133801658 16:9090543-9090565 CGGCACCGCCACGCGGGTTCGGG + Intergenic
1142149591 16:88506742-88506764 CAGCGCCCCTCAGAGGGTCCAGG - Intronic
1143639880 17:8189847-8189869 CGGCGCCCCCCTGCGGCTCCCGG + Exonic
1148579379 17:48733228-48733250 CGCCGCGCCCCCGGGGGTTCCGG + Intergenic
1148755967 17:49973096-49973118 GGGCGCCGCTCGGAGGGTTCCGG - Exonic
1152701815 17:81823218-81823240 CGGTGCCCCTCCCCGGCCTCCGG - Exonic
1152793067 17:82292616-82292638 CTGCGCTCCTCCCCGGGGTCTGG - Intergenic
1153040969 18:812471-812493 CAGGTCCCCTCCGCGGGCTCCGG + Exonic
1156118965 18:33820247-33820269 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1156118977 18:33820275-33820297 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1156118989 18:33820303-33820325 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1156119001 18:33820331-33820353 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1156119013 18:33820359-33820381 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1156119025 18:33820387-33820409 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1156119037 18:33820415-33820437 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1156119049 18:33820443-33820465 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1156119061 18:33820471-33820493 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1156119073 18:33820499-33820521 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1156119085 18:33820527-33820549 CGCCGGCCCGGCGCGGGTTCCGG - Intergenic
1158137583 18:54224181-54224203 CGGCGCCCCCCGGCGGGAGCCGG - Exonic
1161203599 19:3029091-3029113 GGGAGCCCCTCCCCGGGTTGGGG + Exonic
1163106540 19:15125931-15125953 CCACGCCCCTCAGCGGCTTCAGG + Intergenic
1166317905 19:41998951-41998973 CGGCGCGCCTCCGCGTGGCCTGG - Exonic
1167080875 19:47275316-47275338 CTTCGCCCCTCCGCGGCCTCTGG - Exonic
925068863 2:950875-950897 CCGCGCCCCTCTGCCGGCTCCGG - Exonic
929468727 2:42169772-42169794 TGCCGCCCCTCCGCGGACTCCGG + Intronic
938728773 2:134130069-134130091 CGGCGCTCCTCCGCAGCTGCTGG - Intronic
940036814 2:149320401-149320423 CGGAGCCACCCCGCGGGCTCAGG + Intergenic
941929993 2:170929502-170929524 CGCCGCTCCTTCGCGGGATCGGG - Intronic
946247584 2:218396376-218396398 CTGCGGCCCTCCGCAGGTCCTGG - Exonic
948473627 2:238203086-238203108 CGTCGCCCGCCCGCGGCTTCCGG - Intronic
1175282479 20:57813320-57813342 CTGCGCCCCTCTGAGGGTTGTGG + Intergenic
1185153351 22:49178941-49178963 GGGCGCCCCTCTGCAGGTGCTGG + Intergenic
965882116 3:173398173-173398195 CTGCGCTCCGCCGAGGGTTCAGG - Intronic
966849343 3:184155288-184155310 CGGCGCCTCTCCGCGGCGGCCGG + Intronic
971279941 4:25234410-25234432 CGGAGCCGCCCCGCGGTTTCAGG + Exonic
985997807 5:3606473-3606495 CGGCGCCCCTCCGCGAGGAAAGG + Intergenic
990381234 5:55223442-55223464 CGGCGGCCCTGCGCCGGCTCCGG + Intronic
994197448 5:96936006-96936028 CGGCGCCGCTCCGCCGTTCCGGG - Exonic
996937497 5:128965526-128965548 CTGAGCCCCTGCGCGGTTTCTGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1002211953 5:177604569-177604591 CGGCACCCCTGCCCGGGCTCAGG + Intronic
1018774213 6:166998864-166998886 CGGCGCCCCCCCGGGGCTGCAGG + Intergenic
1018942660 6:168319656-168319678 CGGCGCCGCTCGTGGGGTTCGGG - Exonic
1019812583 7:3175396-3175418 AGGAGCCCCTCCCAGGGTTCTGG - Intergenic
1020089775 7:5332654-5332676 CGGCGTCCTTGCGCGGGCTCAGG + Exonic
1024579868 7:50793074-50793096 CGCCGCGCCTCCGCGGGGCCCGG + Intronic
1034225016 7:149475127-149475149 CGGGCCCCGTCCTCGGGTTCAGG + Exonic
1034589553 7:152128222-152128244 AGGCGCCCCTGGGCAGGTTCTGG - Intergenic
1034617921 7:152435512-152435534 CGGCGCCCCCCGGCGGGGTGGGG - Intronic
1035201909 7:157273096-157273118 CCGCGCCCCTCCCCGGCTTGGGG + Intergenic
1048008405 8:130437737-130437759 CAGCGCCCACCCGCGGCTTCTGG - Intronic
1049659925 8:143815400-143815422 CGGCGGCGCTCGGCGGGCTCGGG + Intergenic
1057432171 9:95004750-95004772 CGCCACCCCTCCCCGGGCTCCGG - Intronic
1062333121 9:136053185-136053207 CGGCGCCCCTCTGAGGCATCCGG + Intronic
1189465743 X:41276446-41276468 CCTCCTCCCTCCGCGGGTTCTGG - Intergenic
1192639236 X:72846967-72846989 CTCCGCCCCTCCCAGGGTTCTGG - Intronic
1192642475 X:72873838-72873860 CTCCGCCCCTCCCAGGGTTCTGG + Intronic