ID: 1075646845

View in Genome Browser
Species Human (GRCh38)
Location 10:124102430-124102452
Sequence ACCAGGGTATGGAGGGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075646845_1075646861 29 Left 1075646845 10:124102430-124102452 CCAAGGGCCCTCCATACCCTGGT No data
Right 1075646861 10:124102482-124102504 CCGCCATCCCCAGGTCTAAGAGG No data
1075646845_1075646862 30 Left 1075646845 10:124102430-124102452 CCAAGGGCCCTCCATACCCTGGT No data
Right 1075646862 10:124102483-124102505 CGCCATCCCCAGGTCTAAGAGGG No data
1075646845_1075646855 20 Left 1075646845 10:124102430-124102452 CCAAGGGCCCTCCATACCCTGGT No data
Right 1075646855 10:124102473-124102495 CTGCCCCTCCCGCCATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075646845 Original CRISPR ACCAGGGTATGGAGGGCCCT TGG (reversed) Intergenic
No off target data available for this crispr