ID: 1075649593

View in Genome Browser
Species Human (GRCh38)
Location 10:124118974-124118996
Sequence GGGCTGACTCACCTGCAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075649593_1075649597 -1 Left 1075649593 10:124118974-124118996 CCCAACTGCAGGTGAGTCAGCCC No data
Right 1075649597 10:124118996-124119018 CGCGTATGCCAGTGCTCTGAAGG No data
1075649593_1075649598 3 Left 1075649593 10:124118974-124118996 CCCAACTGCAGGTGAGTCAGCCC No data
Right 1075649598 10:124119000-124119022 TATGCCAGTGCTCTGAAGGATGG No data
1075649593_1075649600 30 Left 1075649593 10:124118974-124118996 CCCAACTGCAGGTGAGTCAGCCC No data
Right 1075649600 10:124119027-124119049 GAGCCATCTCCCTTTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075649593 Original CRISPR GGGCTGACTCACCTGCAGTT GGG (reversed) Intergenic
No off target data available for this crispr