ID: 1075651781

View in Genome Browser
Species Human (GRCh38)
Location 10:124132161-124132183
Sequence AGGGGTGGCAGGTGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075651781_1075651784 -7 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651784 10:124132177-124132199 CACCCCTCCTAGAACCTTCCTGG No data
1075651781_1075651799 29 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651799 10:124132213-124132235 GCACTGCCTCTTCCTTGGAGTGG No data
1075651781_1075651789 -4 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651789 10:124132180-124132202 CCCTCCTAGAACCTTCCTGGGGG No data
1075651781_1075651796 7 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651796 10:124132191-124132213 CCTTCCTGGGGGGAGCTGGGAGG No data
1075651781_1075651794 4 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651794 10:124132188-124132210 GAACCTTCCTGGGGGGAGCTGGG No data
1075651781_1075651785 -6 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651785 10:124132178-124132200 ACCCCTCCTAGAACCTTCCTGGG No data
1075651781_1075651791 -3 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651791 10:124132181-124132203 CCTCCTAGAACCTTCCTGGGGGG No data
1075651781_1075651787 -5 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651787 10:124132179-124132201 CCCCTCCTAGAACCTTCCTGGGG No data
1075651781_1075651798 24 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651798 10:124132208-124132230 GGGAGGCACTGCCTCTTCCTTGG No data
1075651781_1075651793 3 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651793 10:124132187-124132209 AGAACCTTCCTGGGGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075651781 Original CRISPR AGGGGTGGCAGGTGCTCAGC AGG (reversed) Intergenic
No off target data available for this crispr