ID: 1075651782

View in Genome Browser
Species Human (GRCh38)
Location 10:124132172-124132194
Sequence AAGGTTCTAGGAGGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075651782_1075651801 22 Left 1075651782 10:124132172-124132194 CCTGCCACCCCTCCTAGAACCTT No data
Right 1075651801 10:124132217-124132239 TGCCTCTTCCTTGGAGTGGAGGG No data
1075651782_1075651800 21 Left 1075651782 10:124132172-124132194 CCTGCCACCCCTCCTAGAACCTT No data
Right 1075651800 10:124132216-124132238 CTGCCTCTTCCTTGGAGTGGAGG No data
1075651782_1075651798 13 Left 1075651782 10:124132172-124132194 CCTGCCACCCCTCCTAGAACCTT No data
Right 1075651798 10:124132208-124132230 GGGAGGCACTGCCTCTTCCTTGG No data
1075651782_1075651793 -8 Left 1075651782 10:124132172-124132194 CCTGCCACCCCTCCTAGAACCTT No data
Right 1075651793 10:124132187-124132209 AGAACCTTCCTGGGGGGAGCTGG No data
1075651782_1075651794 -7 Left 1075651782 10:124132172-124132194 CCTGCCACCCCTCCTAGAACCTT No data
Right 1075651794 10:124132188-124132210 GAACCTTCCTGGGGGGAGCTGGG No data
1075651782_1075651796 -4 Left 1075651782 10:124132172-124132194 CCTGCCACCCCTCCTAGAACCTT No data
Right 1075651796 10:124132191-124132213 CCTTCCTGGGGGGAGCTGGGAGG No data
1075651782_1075651799 18 Left 1075651782 10:124132172-124132194 CCTGCCACCCCTCCTAGAACCTT No data
Right 1075651799 10:124132213-124132235 GCACTGCCTCTTCCTTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075651782 Original CRISPR AAGGTTCTAGGAGGGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr