ID: 1075651783

View in Genome Browser
Species Human (GRCh38)
Location 10:124132176-124132198
Sequence CAGGAAGGTTCTAGGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075651783_1075651801 18 Left 1075651783 10:124132176-124132198 CCACCCCTCCTAGAACCTTCCTG No data
Right 1075651801 10:124132217-124132239 TGCCTCTTCCTTGGAGTGGAGGG No data
1075651783_1075651799 14 Left 1075651783 10:124132176-124132198 CCACCCCTCCTAGAACCTTCCTG No data
Right 1075651799 10:124132213-124132235 GCACTGCCTCTTCCTTGGAGTGG No data
1075651783_1075651798 9 Left 1075651783 10:124132176-124132198 CCACCCCTCCTAGAACCTTCCTG No data
Right 1075651798 10:124132208-124132230 GGGAGGCACTGCCTCTTCCTTGG No data
1075651783_1075651800 17 Left 1075651783 10:124132176-124132198 CCACCCCTCCTAGAACCTTCCTG No data
Right 1075651800 10:124132216-124132238 CTGCCTCTTCCTTGGAGTGGAGG No data
1075651783_1075651796 -8 Left 1075651783 10:124132176-124132198 CCACCCCTCCTAGAACCTTCCTG No data
Right 1075651796 10:124132191-124132213 CCTTCCTGGGGGGAGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075651783 Original CRISPR CAGGAAGGTTCTAGGAGGGG TGG (reversed) Intergenic
No off target data available for this crispr