ID: 1075651796

View in Genome Browser
Species Human (GRCh38)
Location 10:124132191-124132213
Sequence CCTTCCTGGGGGGAGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075651781_1075651796 7 Left 1075651781 10:124132161-124132183 CCTGCTGAGCACCTGCCACCCCT No data
Right 1075651796 10:124132191-124132213 CCTTCCTGGGGGGAGCTGGGAGG No data
1075651782_1075651796 -4 Left 1075651782 10:124132172-124132194 CCTGCCACCCCTCCTAGAACCTT No data
Right 1075651796 10:124132191-124132213 CCTTCCTGGGGGGAGCTGGGAGG No data
1075651783_1075651796 -8 Left 1075651783 10:124132176-124132198 CCACCCCTCCTAGAACCTTCCTG No data
Right 1075651796 10:124132191-124132213 CCTTCCTGGGGGGAGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075651796 Original CRISPR CCTTCCTGGGGGGAGCTGGG AGG Intergenic
No off target data available for this crispr