ID: 1075653638

View in Genome Browser
Species Human (GRCh38)
Location 10:124146957-124146979
Sequence TTAGCCAGGGGCTATTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075653638_1075653645 -5 Left 1075653638 10:124146957-124146979 CCTCTGAAATAGCCCCTGGCTAA No data
Right 1075653645 10:124146975-124146997 GCTAAGGGCCTGGTCTATGCAGG No data
1075653638_1075653650 29 Left 1075653638 10:124146957-124146979 CCTCTGAAATAGCCCCTGGCTAA No data
Right 1075653650 10:124147009-124147031 TGGCTGACATTGCTAGTGGCTGG No data
1075653638_1075653649 25 Left 1075653638 10:124146957-124146979 CCTCTGAAATAGCCCCTGGCTAA No data
Right 1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG No data
1075653638_1075653647 9 Left 1075653638 10:124146957-124146979 CCTCTGAAATAGCCCCTGGCTAA No data
Right 1075653647 10:124146989-124147011 CTATGCAGGTGTTCACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075653638 Original CRISPR TTAGCCAGGGGCTATTTCAG AGG (reversed) Intergenic
No off target data available for this crispr