ID: 1075653643

View in Genome Browser
Species Human (GRCh38)
Location 10:124146970-124146992
Sequence ATAGACCAGGCCCTTAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075653643_1075653649 12 Left 1075653643 10:124146970-124146992 CCCTGGCTAAGGGCCTGGTCTAT No data
Right 1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG No data
1075653643_1075653650 16 Left 1075653643 10:124146970-124146992 CCCTGGCTAAGGGCCTGGTCTAT No data
Right 1075653650 10:124147009-124147031 TGGCTGACATTGCTAGTGGCTGG No data
1075653643_1075653647 -4 Left 1075653643 10:124146970-124146992 CCCTGGCTAAGGGCCTGGTCTAT No data
Right 1075653647 10:124146989-124147011 CTATGCAGGTGTTCACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075653643 Original CRISPR ATAGACCAGGCCCTTAGCCA GGG (reversed) Intergenic
No off target data available for this crispr