ID: 1075653646

View in Genome Browser
Species Human (GRCh38)
Location 10:124146983-124147005
Sequence GGTGAACACCTGCATAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075653646_1075653650 3 Left 1075653646 10:124146983-124147005 CCTGGTCTATGCAGGTGTTCACC No data
Right 1075653650 10:124147009-124147031 TGGCTGACATTGCTAGTGGCTGG No data
1075653646_1075653649 -1 Left 1075653646 10:124146983-124147005 CCTGGTCTATGCAGGTGTTCACC No data
Right 1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075653646 Original CRISPR GGTGAACACCTGCATAGACC AGG (reversed) Intergenic
No off target data available for this crispr